При насморке как мазать звездочкой: «звездочка» от насморка, при гайморите и для ингаляций: инструкция по применению

Содержание

маленькие истории про «Звездочку» – PostPost.Media

С ее помощью можно было симулировать ОРЗ, вылечиться от всех болезней и сделать из обычной сигареты ментоловую. Ее было трудно найти, легко потерять и невозможно открыть. Мы собрали подборку историй про «Звездочку» — бальзам «Золотая звезда», который для многих заменял целую аптечку. Огромное спасибо всем, кто поделился с нами историями.


Мне в городе Эммаусе, когда там еще не было никакого Нашествия, а была тоска и слепни, объяснили, что, чтобы сделать из обычной сигареты ментоловую, нужно достать фильтр, смазать его кончик, который не к губам, звездочкой, а потом вставить обратно. Работало. (Светлана Орлова)


Мама работала секретарем в адвокатуре. Я, мелкая, частенько восседала на сейфе и наблюдала жизнь раннего прототипа опенспейса. Первая половина восьмидесятых, «Звездочку» доставали по знакомству и блату. Старый (по моим меркам) адвокат с бородкой, вальяжно прохаживаясь между столами, с шиком доставал из кармана бальзам и с протяжным кряхтением и стонами наслаждения натирал им виски.

Боролся с головной болью. (Larisa Romanova)


В 11 лет впервые в жизни отправилась в поход с ночевкой, и меня ужасно доставали комары. Я мазала щеки «Звездочкой», и вроде бы немного помогало. Всю баночку за два дня вымазала. Полную. На следующий день после возвращения мы пошли купаться, и я заметила, что щеки начало пощипывать. Подумала, что натерла резинками от маски для плавания, но назавтра стало еще хуже, по скулам пошли ярко-красные полосы, а потом образовалась полноценная драконья чешуя. Две недели я облезала, и все лето меня звали «звездным Ихтиандром». (Yolka Greengold)


В подростковом возрасте, когда я уже лечилась от простуд сама, я нашла в домашней аптечке «Звездочку» и решила вылечить ею свой насморк. Для этого я использовала мизинец и тщательно намазала мазью обе ноздри изнутри (думала, что так надо). Следующие полчаса были веселыми и незабываемыми. (Лиза Величко)


Когда мне было лет 10 и я в очередной раз заболела каким-то ОРЗ, мама принесла «Звездочку». И открыла. Рядом со мной. А потом сказала, что намажет ЭТИМ мне прямо под носом, вот там, где начинаются ноздри. Я полностью верила и доверяла маме. Мама научила меня промывать нос по йоговскому методу (слова «йога» я тогда не знала, но и в нынешнем возрасте среди друзей–не йогов я единственная, кто это умеет и не боится делать). Но этот жуткий, резкий, чудовищный запах? Намазать на меня? Зачем, почему? Мне было очень сложно поверить, что эта гадость способна лечить ОРЗ. Ну, пришлось… Мне еще и сок алоэ в нос капали. Как только я выросла и стала более-менее сама строить свой быт — никакой «Звездочки» у меня в аптечке больше никогда не водилось. Да и алоэ дома я тоже не держу. (Nadia Shakhova-Mkheidze)


У нас в классе с помощью «Звездочки» симулировали симптомы ОРЗ. Нужно было натереть слизистую носа и внутренние уголки глаз. Насморк и слезотечение обеспечены! Но, кажется, про этот фокус быстро прознала наша школьная медсестра, да и ощущения были так себе, поэтому мода на «Звездочку» продержалась недолго. (Татьяна Бушенко)


Как-то намазалась «Звездочкой» перед выходом, а оказалось — мы идем во вьетнамский ресторан. Все долго стебались, как удачно я подобрала парфюм. (Яна Михайлова)


Мама обожала «Звездочку» и лечила нас с братом только ею. От насморка, от ангины, от кашля. Однажды при сильном насморке, когда под носом уже все красное и раздраженное, она вместо обычной процедуры «намазать акупунктурные точки» типа с двух сторон на переносицу (чтоб глаза щипало) и посередине между бровями точку, мазнула мне под носом. По красному и воспаленному. С мыслью, «чтоб деточка подышала парами, нос раскроет». Аааааасука, как это было больно… (Саша Смоляк)


Мой папа рассказывал, как его одноклассник ради мести намазал ручку двери в классе «Звездочкой». Дело в том, что их учительница перед уроком все время терла уголки глаз, и в этот раз сделала то же самое. Папа говорит, что за весь урок она никак не показала своих страданий, но каждого ученика вызвала, спросила и поставила два. (Catherine Tortunova)


При переезде в другую страну взяла с собой старую баночку «Звездочки» в том числе. Ее час настал, конечно, во время зимней простуды. Итак, я дома одна, живу одна, денег у меня крайне мало (да и тащиться в аптеку больной так себе идея), и лечиться приходится подручными средствами. Естественно, открыть этот металлический кусок говна я не смогла. Подцепить крышку лезвием ножа не удалось. Я погуглила. Нашла кучу советов от умственно отсталых: «Зажмите банку плоскогубцами / ножницами / тисками / орехоколом / магнитом и открутите крышку»; я спокойно могла держать банку в руках, но крышка не крутилась; магнит и плоскогубцы, разумеется, никак не повлияли на ситуацию. Пожаловалась подруге. Подруга с энтузиазмом пошла в гугл и стала давать мне все более экзотические советы. Я катала эту гребаную банку ребром по столу. Грела. Остужала. Кидала об стены, пол и асфальт со второго этажа. Не выдержала, взяла нож и… обнаружила, что у меня нет молотка. В общем, не помню уже, как я справилась, но до сих пор у меня хранится банка «Звездочки» с пробитой и изрезанной в клочья металлической крышкой — и кровожадная ненависть к тем ублюдкам, которые спроектировали такую баночку.

(Катя Островская)


У нас дома «Звездочку» называли «Тигрушкой». Я всегда думала, потому что дерет. А оказалось, что в Голландии есть китайский «тигровый бальзам». (Oxana Yarosh)


«Звездочкой» мы как-то не слишком часто пользуемся, но она всегда есть — примагничена к магнитикам на холодильнике, чтобы не потерять. Если немного нос закладывает, мажем однократно под носом и в проекции пазух. (Ekaterina Shishatskaya)


«Звездочка» у меня до сих пор есть. Привозят по блату из Москвы. Вещь! (Tania Tomer)


У меня кот дурел от запаха «Звездочки» и лез вылизывать намазанную часть тела. Это прям было двойное испытание: терпеть этот запах и попутно отгонять кота от себя. (Наталья Бондаренко)


«Звездочкой» лечили все. Поэтому когда моя сестра нечаянно попала мне пяткой в глаз, было решено мазать «Звездочкой». Потому что «чем же еще?» Адская боль и попытка смыть несмываемое запомнились на всю жизнь. (Юлия Соколова)


«Звездочка» у нас в доме была, но пользовались ею не часто. Обычно над ней дышали, когда закладывало от насморка нос или болело горло. В кастрюльку с горячей водой кидали каплю этой мази и глубоко дышали этим, мягко говоря, ароматным паром, накрывшись большим полотенцем. От такой «ароматерапии» насморк проходил почти мгновенно — по крайней мере, нос начинал дышать и чувствовать запах «Звездочки». Но однажды я сильно заболела гриппом, и был он совсем не кстати. Я судорожно искала средство для быстрого выздоровления, и тут позвонила подруга. Услышав мои стенания, она дала совет намазать «Звездочкой» какие-то точки на лбу, около носа, за ушами и, главное, намазать полностью большой палец на правой руке. Обещала, что средство верное, и завтра я буду здорова. Критическое мышление в том моем гриппозном состоянии было на нуле, и я добросовестно все это выполнила. Буквально минут через десять у меня началось дикое сердцебиение, меня колотило и подкидывало, зубы выбивали «морзянку», лицо горело. Мне было так плохо! В какой-то момент я решила, что уже все — я умираю.

Но постепенно сердце начало замедлять ход, но билось гулко, как будто у меня в груди был колокол. Потом я провалилась в сон. Наутро я действительно проснулась здоровой. Но «Звездочкой» больше никогда не лечилась — слишком радикальным было лечение. (Татьяна Ионова)


Намазать переносицу «Звездочкой» было верным способом заставить меня лечь спать — открыть глаза же было невозможно. (Tonya Nikishyna)


Растворить немного «Звездочки» в ковше для воды, которую плескают на каменку в парилке. Будет классно! Главное — не перебрать с количеством, определяя комфортную для себя дозу опытным путем. Как вариант, использовать ее дома в горячей ванне тоже неплохо. (Cyprian_Norwid)


У меня в прошлом году жена захворала. Кашель, сопли, температура, дышать трудно. Отправила в аптеку за каким-то «фуфломицином». Я на витрине увидел «Звездочку» (тут пошли вьетнамские флешбэки). Купил, пришел домой. Налил кипятка в кружку, на кончике чайной ложки добавил этот божественный бальзам, дал воронку и сказал дышать.

Вдох через рот, выдох через нос. Сначала меня обвиняли в попытке убийства, издевательствах, пытках и прочих прелестях. Заставил дышать, пока раствор не подостыл. Через полчаса она у меня дышала как положено и удивлялась, где я этому научился. (VitGun)


«Звездочка» проходила таможню у нас часто, брокеры вешались. Так как она была зарегистрирована, то на нее должен был быть отбор проб и образцов с каждой партии. Надо было из контейнера вынуть штук двадцать пачек определенной серии. Температура в контейнере летом под 60-70 градусов — баня. Ментол испаряется. Ребята надевали шорты, снимали майки и в зоне таможенного контроля залезали в контейнеры. Полчаса-час — и с них все текло рекой. Но за кашель и насморк на ближайшие пару месяцев можно было не беспокоиться. (gustaff)


Я это колдовское снадобье, то есть «Звездочку», в ботинки кладу, запах пота отшибает нахер. (HABANERA)


Как пользоваться бальзамом «звездочка» — Немного о ремонте и строительстве

Созданный вьетнамскими учеными бальзам «Золотая звезда» представляет собой сложную композицию из эфирных масел разных лекарственных трав. Средство употребляется как в классической, так и в народной медицине для профилактики и лечения многих болезней.

Вопрос «Как вывести сухие мазоли(куринные жопки) на стопе ноги?» — 2 ответа
Бальзам «Золотая звезда», ранее находившийся на прилавках только в виде мази, на данный момент продается в виде карандаша для ингаляций, назальных капель, пластыря, спрея и сиропа. Независимо от формы выпуска, в бальзам входят : кристаллический ментол, камфора, мятное, гвоздичное, эвкалиптовое, коричное и вазелиновое масла и другие вспомогательные компоненты.

Средство предназначено для лечения насморка, укусов насекомых, мышечной боли, невралгии, радикулита, и облегчения состояния при простуде и гриппе.Бальзам «Золотая звезда» оказывает местнораздражающее воздействие. Он владеет согревающим, противовоспалительным и анальгезирующим эффектом, стимулирует нервные окончания и усиливает кровообращение в местах нанесения.

Но применять его необходимо крайне осторожно, дабы не допустить попадания на слизистые оболочки и на открытые раны. Карандаш для ингаляций направляться применять при заложенности носа либо рините, сопровождающимся обильными выделениями. Дабы уменьшить дыхание, необходимо сделать 1-2 вдоха каждой ноздрей.

Делать ингаляции возможно до 10-15 раз в день. При усилении отека, обильном слезотечении, чихании либо появлении другого рода негативной реакции, лучше прекратить применение карандаша и лечить насморк мазью либо жидким бальзамом.Бальзам «Звездочка», предназначенный для наружного применения, в маленьком количестве втирают в кожу: при насморке ? недалеко от переносицы, гайморовых пазух и под ноздрями; при головной боли ? в области висков и затылка; при бронхолегочных болезнях ? в районе груди и спины, не затрагивая область сердца; при невраглии ? в места, где сконцентрированы болевые ощущения.

Укусы насекомых направляться мазать с особенной осторожностью ? узким слоем, нужно не затрагивая центр. В случае если бальзам «Золотая звезда» употребляется для лечения, наносить его на кожу направляться до пяти раз в день.

В профилактических целях хватит двукратного применения.При применении бальзама «Золотая звезда» может появиться аллергическая реакция. В этом случае место нанесения средства направляться промыть громадным числом горячей мыльной воды.

Детям до двух лет, и беременным и кормящим дамам «Звездочку» применять не рекомендуется. Не следует использовать бальзам и при наличии гиперчувствительности к одному либо нескольким компонентам средства.

Бальзам Звездочка


Вы прочитали статью, но не прочитали журнал…

Как пользоваться звёздочкой при насморке и простуде

Восточные мудрецы всегда уделяли большое внимание народным методам лечения. Они точно знали, что с помощью природных компонентов можно лечить любое заболевание человека, и такое оздоровление всегда дает положительный результат.

Основываясь на добытых знаниях, вьетнамские специалисты разработали уникальный рецепт, который и стал основой для создания современного бальзама «Золотая звезда». В составе этого средства только натуральные природные компоненты, не провоцирующие негативного воздействия на кожу человека.

Эффективность данного средства обусловлена богатым составом полезных эфирных масел, которые, как известно, оказывают положительное влияние на наш организм. Они обладают высокими антисептическими и противовоспалительными свойствами, уничтожают бактерии и устраняют боли. Если мазать звездочкой область кожных покровов, можно почувствовать слегка охлаждающий эффект, что охарактеризовано содержанием ментола в бальзаме.  Кроме этих компонентов, в нем содержится вазелин и камфора, натуральные вещества, обладающие обезболивающими свойствами.

 

Использовать звездочку можно от разных заболеваний, основываясь на рекомендованных методах применения. Из-за богатого состава эфирных масел, бальзам не рекомендован к применению людям, имеющим индивидуальную непереносимость к составляющим компонентам.

Лечение звездочкой рекомендовано при таких заболеваниях:

  • болезни дыхательной системы;
  • простудные и вирусные процессы;
  • лечение суставов и опорно-двигательной системы;
  • для устранения ушибов, травм;
  • при частых мигренях и сильной головной боли;
  • для лечения радикулита;
  • эффективно устраняет зубную боль;
  • помогает снять отечность в области нижних конечностей;
  • снимает зуд после укусов насекомых и т. д.

Бальзам для лечения простудных заболеваний

Звездочку можно эффективно использовать для лечения простудных заболеваний и устранения неприятных симптомов. Самым распространенным признаком воспалительного процесса в организме является насморк. Лечить его можно с помощью эффективного восточного бальзама на основе натуральных компонентов.

Звездочка оказывает высокое лечебное действие больному носу, что обусловлено глубоким проникновением эфирных масел внутрь пазух при вдыхании бальзама. Чтобы лечение этим составом повлекло положительный результат, рекомендуем правильно проводить процедуру оздоровления.

Бальзам «Золотая звезда» представлен в ассортименте фармацевтических средств в трех основных позициях: ингаляционный карандаш, жидкий бальзам и кремообразный состав. Для лечения насморка рекомендован карандаш для проведения эффективных ингаляций в домашних условиях.

Лечить простудный симптом этим средством легко и доступно! Вдыхать целебные ароматы через специальные отверстия в мини-ингаляторе можно даже по пути на работу. Компактный флакон, напоминающий помаду для губ, легко умещается в кармане и сумочке. Эффект от такого средства ощущается уже после первых вдохов через носовые пазухи, моментально устраняется заложенность носа и предотвращаются очередные выделения.

Бальзам кремообразной консистенции можно мазать в области крыльев носа. Другие рекомендованные точки для лечения насморка звездочкой: виски, мочки ушей, зона над верхней губой и промежуток между бровями.

Лечение насморка у детей бальзамом звездочка

Пользоваться бальзамом звездочка можно не только взрослым, но и детям, если при пробном лечении не была выявлена аллергическая реакция или индивидуальная непереносимость эфирных компонентов. Чтобы не допустить попадания в глаза, наносить средство на кожу ребенка должны родители. Внимательно контролируйте процесс нанесения бальзама, не допускайте растирания обработанной области руками маленького пациента.

Использовать восточное лечебное средство натурального состава можно при простуде и насморке. Лечение детей чаще проводится с помощью карандаша-ингалятора, что наиболее безопасно для использования и эффективно для устранения неприятного насморка и заложенности. Ингаляции со звездочкой провоцируют эффективное лечебное действие для слизистой оболочки носа.

При заболеваниях бронхолегочной системы, рекомендуется использовать бальзам для создания лечебных и ароматных ванн. Приятный запах эфирных масел положительно воздействует на всю дыхательную систему, устраняет вирусы и воспалительные процессы.

Многие специалисты также рекомендуют пользоваться звездочкой при проведении лечебного массажа на стопах ног. Эта процедура способствует повышению иммунной системы и стабилизирует функциональность внутренних органов, что обосновано расположением важных точек в области стопы и пяток.

Как правильно пользоваться бальзамом:

  • наносить средство необходимо на определенную точку, что зависит от протекающего заболевания;
  • использовать звездочку необходимо строго по инструкции, в небольшом количестве, чтобы не вызвать ожог кожи;
  • лечение бальзамом может быть проведено только при отсутствии противопоказаний;
  • если после нанесения средства больной почувствовал сильное жжение – нужно прекратить лечение средством, а остатки вещества обильно смыть водой;
  • чтобы не допустить возможных осложнений, перед первым нанесением проведите тестирование кожных покровов на переносимость входящих в состав бальзама компонентов.

Противопоказания к применению:

  • детям до 2 лет не рекомендовано лечение данным средством;
  • беременным женщинам пользоваться бальзамом можно, если запах эфирного состава не провоцирует неприятных ощущений при вдыхании;
  • нельзя применять бальзам, если у больного имеются царапины и другие повреждения кожи в местах, куда будет наносится средство;
  • запрещается мазать бальзамом слизистую носа, это приведет к раздражению и ожогам;
  • ни в коем случае не употреблять внутрь, например, в качестве добавки в чай. Это может вызвать ожоги слизистой и обострение язвенной болезни;
  • индивидуальная непереносимость.

Рейтинг автора

Автор статьи

Потомственный травник. Специалист по народному лечению.  

Написано статей

Звездочка При Беременности | Уроки для мам

“Звёздочка” при беременности  – средство,  которое пользовалось бешеной популярностью в Советском Союзе, и отголоски этих воспоминаний добираются и до нас.

Часто можно услышать, как бабушки, увидев простуженную женщину с пузиком, добродушно советуют – помажь нос “Звёздочкой” и всё пройдет.

А может и вправду пройдет?

Бальзам “Звёздочка” или как его окрестили в народе “вьетнамский бальзам”, действительно обладает способностью снимать головную боль, успокаивать зуд от укусов насекомых и даже лечить простуды.

В составе “Звёздочки” не одно, а несколько распространённых эфирных масел:

  • камфорное,
  • эвкалиптовое,
  • гвоздичное,
  • мятное,
  • коричное.

Основой является вазелин.

“Звёздочка” является симптоматическим средством, т.е. само по себе оно не способно вылечить заболевание, и его основная задача облегчить симптомы.

Поэтому при простуде, и тем более гриппе при беременности не стоит полагаться лишь на одну “Звёздочку”. А вот если Вы доверяете ароматерапии и знаете, что не склонны к аллергии – тогда смело можете попробовать облегчить свое состояние применением “Звёздочки”.

Учитывайте, что “Звёздочку” не рекомендуют наносить на поврежденную кожную ткань.

При насморке, достаточно часто в результате регулярных сморканий крылья носа становятся красными, воспалёнными и образуются микротрещинки на коже. В этом случае “Звёздочка” может вызвать сильное чувство жжения, и даже аллергические реакции, поскольку состав напрямую попадет в кровь.

Правила применения

Все зависит от вашего заболевания.

  1. Если Вас замучил насморк – рекомендуется смазать небольшим количеством препарата крылья носа.
  2. Для профилактики заболевания гриппом и простудами в сезон эпидемий перед выходом из дома можно смазывать “Звёздочкой” участок кожи под носом.
  3. При кашле и затрудненном отхождении мокроты можно сделать легкий массаж спины на уровне лопаток, затрагивая область бронхов. После массажа лучше всего укутаться и погреться.

Важно: в инструкции к препарату написано – «не рекомендуется детям до 2-х лет».

Это говорит о том, что исследований влияния “Звёздочки” на внутриутробного ребенка и на новорожденных не проводилось. Поэтому клинических данных о безопасности “Звёздочки” во время беременности нет.

Однако в период беременности, часто приходится выбирать и нести затем ответственность за свой выбор.

В настоящее время фармацевтика развита достаточно хорошо, и есть более новые, проверенные препараты, которые разрешены в период беременности. Обратитесь к своему лечащему врачу, и он с радостью Вам их порекомендует.

Так что “Звёздочка” просто является пережитком советских времен, который помогает верящим в её действие людям и в наши дни.

А вы верите?

Автор: провизор Евгения Вирт

Бальзам Звездочка.

Насморк, ринит, профилактика гриппа. Точки для лечения

Насморк, риниты можно лечить самыми различными способами. При самых первых признаках начинающегося насморка поможет массаж — легкое постукивание подушечками пальцев по ноздрям и выше переносицы. Это нужно проделать несколько раз. Такой прием можно применить и тогда, когда очень захочется чихнуть, а сделать это неприлично (например, на какой-нибудь торжественной церемонии). А если вы уже заболели, возьмите кусочек натуральной (серой) ваты, подожгите его, тут же задуйте и понюхайте. Будет больно до слез, но недуг уйдет сразу.


Однако для начала хорошо бы выяснить, чем вызван ринит, не является ли он проявлением аллергии. Если же вы уверены, что простудились, и простудились сильно, тогда прибегните к следующему эффективному средству. Возьмите небольшое количество бальзама «Звездочка» и плавными движениями разотрите грудь, не касаясь сосков. Процедуру можно повторять несколько раз (3-4 раза) в сутки. При хронических простудных заболеваниях полезно производить ежедневное растирание спины и груди с небольшим количеством бальзама.

От простуды бальзам «Звездочка», конечно же, не спасает, но в сочетании с массажем спинки носа облегчает дыхание при насморке. Чтобы провести массаж по всем правилам, найдите указательными пальцами две симметричные точки там, где спинка носа переходит в скуловые кости (при надавливании в этих местах вы испытаете распирающее, чуть болезненное ощущение). Здесь находятся рефлекторные зоны, раздражение которых очищает носовые ходы. Затем нанесите на кончики пальцев немного бальзама и в течение 2-3 минут вращательными движениями массируйте данные точки, то усиливая, то уменьшая давление. Повторяйте 5-6 раз в день. Возможно, уже на второй день насморк исчезнет.

Для предохранения от насморка, улучшения кровообращения верхних дыхательных путей рекомендуем сделать массаж точек, изображенных на рис. 1.

Рис. 1

Для массажа нужно потереть область носа наружной стороной указательного пальца до появления чувства «горячего холода». После этого проделайте восемнадцать массажных движений указательными пальцами вдоль носа с обеих сторон. Будьте аккуратны — бальзам не должен попасть в глаза!

Для профилактики гриппа на указательный палец нанесите небольшое количество препарата «Звездочка» и произведите втирание в кожу вокруг носа, в подчелюстной и затылочной областях, где сосредоточено большое количество биологически активных точек. Можно втирать в надбровья. Втирание имеет не только лечебный, но и профилактический эффект. Через некоторое время процедуру следует повторить.

Для профилактики гриппа также отлично помогает оксолиновая мазь.

На начальной стадии гриппа хорошо помогает следующая процедура: намажьте бальзамом «Звездочка» ступню ноги, но не всю, а только пятку и под пальцами, большой палец и над пальцами. А потом на стопе от большого пальца необходимо провести бальзамом к пятке. Затем необходимо надеть грубые шерстяные носки и походить в них. Кроме того, необходимо обильное питье, очень полезны морсы.

Существует один известный способ вылечить простуду за короткий срок. Кстати, средство это уже считается народным. Оно действительно очень хорошо помогает, в чем вы можете убедиться на собственном опыте (хотя мы желаем вам не болеть!). Надо легкими массирующими движениями натереть горло бальзамом «Звездочка», затем завязать горло платком и весь вечер пить липовый чай с медом в больших количествах. Уже на следующее утро вы почувствуете, что совершенно выздоровели.

ДРУГИЕ СТАТЬИ РАЗДЕЛА:


«Звездочка» при беременности

Вьетнамская мазь «Золотая звезда» многим знакома с самого детства. Наши родители пользовались ей довольно часто, особенно когда дело касалось простуды или ОРВИ. И это не спроста, ведь в ее состав входят компоненты растительного происхождения, которые, в отличие от медикаментозных препаратов, не так вредны для организма не только взрослого человека, но и ребенка. Эфирные масла, из которых изготовлена «Звездочка»: эвкалиптовое, коричное, мятное и гвоздичное, прекрасно борются с заложенностью носа, кашлем, головной болью и т.д. Возможно, именно поэтому этот препарат не уходит с полок аптек уже долгие годы. Однако есть один период — время вынашивания малыша, когда любое, даже самое проверенное средство может вызвать тревогу за здоровье крохи.

Можно ли пользоваться «Звездочкой» при беременности?

В инструкции к препарату, причем как к мази, так и к другим формам выпуска, написано, что исследований о применении «Звездочки» при беременности не проводилось, а соответственно, производитель не может гарантировать того, что воздействие средства на организм будущей мамочки и ее плод будет безопасным. Кроме этого, даже квалифицированный врач однозначного ответа на вопрос, можно ли «Звездочку» при беременности, не даст. А все потому, что входящие в ее состав эфирные масла действуют на людей абсолютно по-разному: у одних она может вызвать аллергию или мигрень, а другие будут испытывать только положительный эффект от ее применения. Тем более не стоит забывать о том, что при беременности некоторые процессы в организме у женщины начинают протекать по-иному, и даже проверенные временем средства могут вызвать аллергическую реакцию, чихание, неожиданную тошноту и т.п.

Советы по применению

Многие врачи утверждают, что для того, чтобы понять, можно ли именно вам использовать «Звездочку» при беременности стоит придерживаться некоторых рекомендаций:

  1. Проведите тест на аллергию. Для этого небольшое количество средства нанесите на запястье или локтевой сгиб с тыльной стороны и отследите реакцию в течение четырех часов. Если вы не обнаружите покраснений, зуда, высыпаний, то можете смело им пользоваться.
  2. Запах мази не должен вызывать негативных реакций. Не стоит мучить себя или вашего малыша достаточно специфическим запахом этого препарата, если вам он неприятен.

Кроме этого существует два аспекта, при которых ответ на вопрос, можно ли применять бальзам или мазь «Звездочка» беременным, всегда будет отрицательным:

  • если до беременности препарат вам не подходил;
  • если средство будет наноситься на слизистые или поврежденные участки тела.

В последнем случае нужно быть особенно бдительной, ведь очень часто именно его применяют при лечении насморка. Поэтому ответ на вопрос, можно ли беременным мазать нос «Звездочкой», будет только тогда положительным, когда он не растерт до микротрещин, а препарат наносится аккуратно и тонким слоем.

Как применять мазь «Звездочку» при беременности?

Сразу хочется обратить внимание будущих мамочек на то, что этот препарат, когда он используется для участков головы и лица, втирать запрещено. Поэтому перед применением «Звездочка» растирается между пальцами и наносится три раза в день по следующим схемам:

  • при головной боли: на лоб, виски и затылочную часть головы;
  • при заложенности носа: на крылья носа и под него;
  • при заболеваниях горла: под скулы, в области небных миндалин (гланд), с обязательным применением после аппликации шарфа или другой повязки для согревающего эффекта.

Что же касается лечения кашля, в случае, если у будущей мамочки на этот препарат нет аллергии, то врачи допускают его применение с втиранием в кожу в области местонахождения бронхов. Однако стоит помнить, что после этой процедуры должен быть постельный режим и теплая одежда, которая поможет сберечь тепло.

Итак, на вопрос, можно ли беременным мазаться «Звездочкой», однозначного ответа врачи дать не могут. Но если у вас нет негативных реакций на составляющие этого средства, а простуда просто замучила, то попробуйте с осторожностью применить вьетнамскую мазь, ведь хорошее самочувствие, особенно в период беременности, — это очень важно.

 

что не нужно мазать им — Рамблер/новости

Маленькие коробочки с этой мазью завезли в СССР из Вьетнама в начале восьмидесятых, и они быстро завоевали популярность — средство было новое, импортное и недорогое. Чудо-мазью пытались вылечить совершенно разные недуги, часто используя «Звёздочку» не по назначению. Мазь не потеряла славу и в наши дни, поэтому в этой статье разберёмся, как её правильно использовать и какие опасности она содержит.

В состав оригинальной мази входят препараты, которые сами вьетнамцы используют в своих лекарствах. Это полностью натуральный препарат, который состоит из ментола, камфоры, мятного, эвкалиптового, гвоздичного, вазелинового масел, пчелиного воска и парафина.

Правильное использование

Во Вьетнаме врачи используют «Золотую Звезду» — а именно так её называют на родине — при многих заболеваниях, ведь там она считается довольно эффективной. В основном мазь используют при простудах, насморках и прочих аналогичных заболеваниях. Препаратом пользуются с учетом точек акупунктуры — различных мест на теле человека, которые, по китайским традициям, отвечают за отдельные недуги.

Такие разогревающие бальзамы используют для обезболивания, увеличения кровотока, устранения отёков при проблемах со связками, сухожилями и суставами. Принцип их работы прост и очень эффективен: они согревают кожу, заставляют кровь прилить к месту нанесения, снимают отёчность, расслабляют мышечную ткань. «Звёздочку» можно втирать на определенные места: при головной боли — виски, простудное заболевание лечится втиранием в спину, грудь и живот.

«Золотая Звезда» также отлично помогает от комариных укусов — мазь так сильно охлаждает, что кожа сосредотачивается не на раздражении от укуса, а на прохладном действии препарата.

Как не стоит использовать «Звёздочку»

Важно: бальзам ни в коем случае нельзя наносить на слизистые! Например, в нос. При попадании на такие участки мазь вызывает сильную реакцию и неприятные ощущения, которые могут не проходить несколько дней подряд.

Также подобные разогревающие мази часто используют неправильно — при различных травмах, растяжениях их не стоит втирать, а нужно просто нанести и подождать, пока мазь впитается. Разогревающие мази используют для обезболивания, увеличения кровотока, устранения отёков. Растирание может привести к дополнительному повреждению.

Если мазь используется для лечения простуды и улучшения самочувствия, то втирание не противопоказано.

Противопоказания

Как видно из состава мази, все компоненты, входящие в нее являются очень сильными аллергенами. Если у вас когда-либо была аллергия на цветы, деревья и другие растения, этот препарат стоит использовать только после пробы — нанесите небольшое количество мази на внутреннюю сторону запястья. Если почувствуете раздражение, то «Звёздочку» вам использовать точно не стоит.

Также не стоит лечить этим препаратом детей до двух лет и беременных женщин — у обоих чувствительность к аллергенам заметно выше, чем у обычного взрослого человека.

Сообщение Бальзам «Звёздочка»: что не нужно мазать им появились сначала на Умная.

Что такое Пап-мазок и что означают мои результаты?

Мазок Папаниколау — это процедура для выявления рака шейки матки и аномальных клеточных изменений шейки матки, которые могут привести к раку шейки матки. Если ваш тест отклонился от нормы, ваш отчет может включать ряд различных результатов, таких как атипичные плоскоклеточные клетки неопределенного значения (ASCUS), которые считаются слегка аномальными, или плоскоклеточное интраэпителиальное поражение (SIL), которое может указывать на то, что клетки выстилают шейку матки предраковые.

В зависимости от результатов и степени поражения вам может потребоваться дополнительное обследование, более частый мониторинг или лечение. Узнайте больше о результатах и ​​возможных следующих шагах.

Environment Images / UIG / Universal Images Group / Getty Images

Что такое Пап-мазок?

Мазок Папаниколау, также называемый тестом Папаниколау, включает сбор клеток из влагалища и шейки матки — нижнего узкого конца матки, который находится в верхней части влагалища. Мазок Папаниколау обычно делается в сочетании с гинекологическим осмотром.Тест на ВПЧ — это тест на штаммы ВПЧ с высоким риском (штаммы, вызывающие рак), который может быть выполнен одновременно с мазком Папаниколау, но также может быть выполнен на образце мазка Папаниколау после того, как он был отправлен в лабораторию.

Начиная с 25 лет, либо тест на первичный папилломавирус человека (ВПЧ), либо комбинация теста на ВПЧ и мазка Папаниколау рекомендуется каждые пять лет до 65 лет. Если первичное тестирование на ВПЧ недоступно, рекомендуется сдавать мазок Папаниколау каждые пять лет. три года. Если тест отклоняется от нормы, может быть рекомендовано более частое тестирование и / или дальнейшая оценка.Взаимодействие с другими людьми

Эти рекомендации предназначены для людей со средним риском развития рака шейки матки. Тем, кто имеет повышенный риск, например тем, кто принимает иммунодепрессанты или болен ВИЧ, могут быть рекомендованы дополнительные меры скрининга. Тем, у кого в прошлом были аномальные результаты, также часто рекомендуется более частое обследование.

ВПЧ — очень распространенное заболевание, передающееся половым путем, которое может привести к раку шейки матки у некоторых женщин. Хотя существует множество штаммов ВПЧ, только определенные штаммы связаны с раком шейки матки, и тест на ВПЧ разработан специально для выявления этих штаммов.

Результаты нормального мазка Папаниколау

Если ваш мазок Папаниколау считается нормальным, ваш врач также рассмотрит результаты вашего теста на ВПЧ (или порекомендует провести тест на том же образце, если он ранее не проводился).

Если и ваш мазок Папаниколау, и тест на ВПЧ в норме (и если у вас в прошлом не было аномальных мазков Папаниколау / тестов на ВПЧ), вам, скорее всего, не потребуется никаких дальнейших анализов или лечения, пока не будет рекомендован следующий скрининговый тест (пять лет для тестирования на ВПЧ или котестинга).

Папаниколау нормальный, но положительный тест на ВПЧ

Если ваш мазок Папаниколау в норме, но ваш тест на ВПЧ положительный, ваш врач обсудит с вами возможные рекомендации. Это может происходить по нескольким причинам. Чаще всего это означает, что инфекция ВПЧ присутствует, но не вызывает каких-либо аномалий в клетках шейки матки. Большинство инфекций ВПЧ проходят, не вызывая патологий или рака.

С другой стороны, могло случиться так, что образец мазка Папаниколау не обнаружил область аномальных клеток (ложноотрицательный).Рекомендации могут отличаться в зависимости от вашего возраста, вашего прошлого тестирования на ВПЧ и того, был ли ваш тест положительным на ВПЧ 16 или 18. Они могут включать более раннее наблюдение или проведение кольпоскопии.

Ненормальные результаты мазка Папаниколау

Если во время мазка Папаниколау были обнаружены аномальные или необычные клетки, у вас считается положительный результат.

Положительный результат не означает, что у вас рак шейки матки. Что означает положительный результат, зависит от типа клеток, обнаруженных в вашем тесте.

Вот несколько терминов, которые может использовать ваш врач, и каковы могут быть ваши следующие действия:

Атипичные плоские клетки неустановленной значимости

Один из возможных аномальных результатов — атипичные плоскоклеточные клетки неопределенной значимости или ASCUS. Плоские клетки тонкие и плоские и растут на поверхности здоровой шейки матки.

В случае ASCUS мазок Папаниколау выявляет слегка ненормальные плоскоклеточные клетки, но изменения явно не указывают на присутствие предраковых клеток.

На самом деле, хотя результат мазка Папаниколау может вызывать тревогу, он считается лишь слегка отклоняющимся от нормы и на самом деле является наиболее распространенным отклонением от нормы в результате мазка Папаниколау, который вы можете получить. Фактически, непосредственного риска рака шейки матки может не быть. с результатом мазка Папаниколау ASCUS.

Наиболее частыми причинами результатов мазка Папаниколау по ASCUS являются доброкачественные (доброкачественные) состояния, такие как инфекции или воспаление. Эти состояния могут привести к появлению аномальных клеток шейки матки. Однако со временем большинство клеток возвращаются к нормальному виду.

У некоторых женщин результат ASCUS связан с изменениями в клетках шейки матки, вызванными инфекцией ВПЧ. С помощью мазка Папаниколау на жидкой основе ваш врач может повторно проанализировать образец, чтобы проверить наличие определенных факторов высокого риска. типы вируса ВПЧ, которые, как известно, способствуют развитию рака, например рака шейки матки.

Если вирусов высокого риска нет, аномальные клетки, обнаруженные в результате теста ASCUS, не вызывают особого беспокойства. Если присутствуют вызывающие беспокойство вирусы, вам потребуется дальнейшее тестирование.

При этом в большинстве случаев эти изменения шейки матки не прогрессируют до рака шейки матки, но требуют дальнейшего наблюдения и возможного лечения для предотвращения повышенного риска рака шейки матки.

Плоскоклеточное интраэпителиальное поражение

Этот термин плоскоклеточное интраэпителиальное поражение (SIL) указывает на то, что клетки, собранные из мазка Папаниколау, могут быть предраковыми. Эти изменения могут быть зарегистрированы как плоское интраэпителиальное поражение низкой степени (LSIL или LGSIL) или как интраэпителиальное поражение высокой степени (HSIL или HGSIL).

LSIL

Если изменения являются низкосортными (LSIL), это означает, что размер, форма и другие характеристики клеток позволяют предположить, что если присутствует предраковое поражение, скорее всего, до того, как он станет раком, пройдут годы (если это вообще произойдет). Эти изменения чаще всего вызваны заражением вирусом ВПЧ, но большинство этих инфекций проходит самостоятельно. Если у вас был мазок Папаниколау, который показывает LSIL, существует умеренный риск развития HSIL (см. Ниже).Взаимодействие с другими людьми

Когда мазок Папаниколау показывает LSIL, первым делом нужно посмотреть тест на ВПЧ (и заказать его, если это не было сделано ранее). Если тест на ВПЧ отрицательный, повторный тест на ВПЧ и мазок Папаниколау могут быть выполнены через один год. Если ваш тест на ВПЧ положительный, особенно на ВПЧ 16 или 18, может быть рекомендована кольпоскопия (с биопсией или без нее).

Конечно, эти рекомендации будут варьироваться в зависимости от вашего возраста, истории аномальных тестов в прошлом, статуса вашей беременности и наличия каких-либо факторов риска, таких как иммуносупрессия.

HSIL

Если изменения высокого уровня (HSIL), есть большая вероятность того, что поражение может перерасти в рак гораздо раньше.

Поскольку только мазок Папаниколау не может определить наличие предраковых клеток, необходимы дальнейшие исследования. Это верно независимо от того, положительный или отрицательный результат вашего теста на ВПЧ.

Часто следующим шагом является кольпоскопия с биопсией любых аномальных областей. Это может определить наличие цервикальной интраэпителиальной неоплазии (CIN) 2, CIN3 или иногда AIS (аденокарцинома in situ).

Если вместо этого риск CIN3 или AIS считается высоким, ваш врач может порекомендовать «ускоренное» лечение, то есть приступить непосредственно к лечению, а не проводить кольпоскопию и биопсию. Варианты лечения включают те, которые удаляют (иссекают) ткань, такие как процедура LEEP или коническая биопсия (конизация лазером или холодным ножом), или те, которые удаляют ткань (например, криохирургия). В США обычно предпочитают эксцизионное лечение.

Атипичные железистые клетки

Железистые клетки производят слизь и растут в шейке матки и внутри матки.Атипичные железистые клетки могут показаться ненормальными, что вызывает опасения по поводу наличия предрака или рака.

Когда на мазке Папаниколау видны атипичные железистые клетки, необходимо дальнейшее тестирование, чтобы определить источник аномальных клеток и их значение. Небеременным женщинам рекомендуется кольпоскопия вместе с биопсией (эндоцервикальная биопсия) независимо от того, положителен ли тест на ВПЧ. Кроме того, женщинам старше 35 лет или тем, у кого есть факторы риска рака матки (рака эндометрия), также рекомендуется биопсия эндометрия.Взаимодействие с другими людьми

Плоскоклеточный рак или клетки аденокарциномы

Если ваш результат сообщает о наличии плоскоклеточной клетки или аденокарциномы, это означает, что клетки, собранные для мазка Папаниколау, выглядят настолько ненормальными, что патолог почти уверен, что это рак.

«Плоскоклеточный рак» относится к раку, возникающему в клетках с плоской поверхностью влагалища или шейки матки. «Аденокарцинома» относится к раку, возникающему в железистых клетках. Если такие клетки будут обнаружены, ваш врач порекомендует незамедлительно провести обследование и лечение. Важно отметить, что мазок Папаниколау содержит набор клеток, но ничего не говорит о взаимоотношениях клеток друг с другом. По этой причине невозможно определить, являются ли обнаруженные раковые клетки карциномой in situ (неинвазивной и теоретически полностью излечимой в случае удаления) или инвазивной (и, следовательно, действительно раковой).

Последующее наблюдение после аномального мазка Папаниколау

Рекомендуемое последующее наблюдение после аномального мазка Папаниколау зависит от результатов, полученного вами лечения, вашего возраста, вашей истории сдачи мазков Папаниколау и тестирования на ВПЧ в прошлом и многого другого.Обычно это включает более частый скрининг в течение определенного периода времени либо с помощью теста на ВПЧ / Папаниколау, либо с помощью кольпоскопии.

Важно отметить, что для людей со значительно аномальными мазками Папаниколау (например, HSIL и выше) и после начального периода усиленного скрининга скрининг (тестирование на ВПЧ или тестирование на ВПЧ плюс мазок Папаниколау) будет требоваться каждые три года для полного 25 лет. Причина этого в том, что риск рака шейки матки при таких результатах сохраняется как минимум 25 лет.Взаимодействие с другими людьми

Дискуссионное руководство для врачей по лечению рака шейки матки

Получите наше руководство для печати к следующему визиту к врачу, которое поможет вам задать правильные вопросы.

Отправить руководство по электронной почте

Отправить себе или близкому человеку.

Зарегистрироваться

Это руководство для обсуждения с доктором отправлено на адрес {{form.email}}.

Произошла ошибка. Пожалуйста, попробуйте еще раз.

Профилактика

Даже если у вас был ненормальный мазок Папаниколау или тест на ВПЧ, важно знать, что, помимо тщательного наблюдения, меры, связанные с образом жизни, могут снизить риск развития рака шейки матки.Например, хотя курение не вызывает рак шейки матки, оно, по-видимому, увеличивает вероятность того, что у людей, у которых развиваются инфекции ВПЧ высокого риска (причина большинства видов рака шейки матки), разовьется болезнь.

Кроме того, вакцинация против ВПЧ (Гардасил 9) рекомендуется всем людям в возрасте от 9 до 26 лет, независимо от того, вели они половую жизнь или нет. Если вы не были вакцинированы в течение этого периода, вы все равно можете получить вакцину до 45 лет. Ваш врач может помочь вам оценить, имеет ли это смысл в вашем случае.

Шведское исследование показало, что среди вакцинированных женщин в возрасте до 17 лет заболеваемость раком шейки матки была на 88% ниже, чем у не вакцинированных. У тех, кто был вакцинирован позже (в возрасте от 17 до 30 лет), заболеваемость была на 53% ниже.

Слово от Verywell

Раннее обнаружение рака шейки матки с помощью мазка Папаниколау дает вам больше шансов на излечение. Еще лучше, когда аномальные изменения могут быть обнаружены (и вылечены) до того, как у них появится возможность развиться до рака шейки матки.Будьте осведомлены о своем здоровье шейки матки и следите за своими мазками Папаниколау. Еще один лакомый кусочек — не заниматься сексом, спринцеваться, использовать тампоны или другие средства гигиены влагалища за 48 часов до мазка Папаниколау, поскольку они могут дать ложные результаты.

Мыши

моделируют безмолвного убийцу

KNOCKOUT PUNCH

Набиль Бардизи, постдок лаборатории DePinho, объясняет, что предыдущие модели мышей использовали трансгенную технологию и промоторы, специфичные для ацинарных или островковых клеток; они генерировали опухолевые клетки ацинарного или островкового типа, которые менее распространены, чем опухоли протоков у людей, говорит он.Напротив, две современные модели используют Cre / lox-опосредованную технологию условного нокаута для точного нацеливания на экспрессию поджелудочной железы с использованием нативных промоторов.

Группа ДеПиньо выбила стопорный элемент, чтобы активировать только ген KRAS, что привело к предраковому состоянию, известному как панкреатическая межэпителиальная неоплазия, или PanIN, которое не прогрессировало до метастатической стадии. Делеция только локуса Ink4a / Arf не приводила к какому-либо заболеванию. «Но когда мы объединили две делеции, мы увидели значительно усиленное прогрессирование этих предраковых поражений до очень запущенных состояний, а также к появлению очень агрессивного злокачественного и метастатического заболевания», — говорит Бардизи. Исследователи пришли к выводу, что KRAS вызывает неоплазию протоков поджелудочной железы, в то время как ген Ink4a / Arf действует как контрольная точка против дальнейшего прогрессирования заболевания.

Tuveson и его коллеги нацеливали только экспрессию KRAS на клетки-предшественники поджелудочной железы мыши для детального изучения прединвазивных повреждений PanIN. По его словам, со временем «у некоторых из этих мышей действительно разовьется инвазивный и прогрессирующий рак поджелудочной железы, включая распространение или метастазы».

Обе исследовательские группы показали, что модели отражают гистологическое прогрессирование рака поджелудочной железы человека.«Это все, что можно, с точки зрения хорошей капитуляции перед человеческим положением», — говорит ДеПиньо. Несколько рецепторов факторов роста, активированных в опухолях протоков поджелудочной железы человека, также были активированы в опухолях мышей, что, по словам Бардизи, дополнительно демонстрирует рекапитуляцию.

ПЕРЕМЕЩЕНИЕ ПОДПИСИ

Тувсон и его коллеги также идентифицировали протеомную сигнатуру сыворотки у мышей с ранним раком поджелудочной железы, открытие, которое может помочь в разработке диагностики для человека. Хотя еще слишком рано определять, похожи ли мышиные маркеры на те, что обнаружены у людей, «демонстрация наличия этой протеомной сигнатуры является важным доказательством принципа того, что можно использовать эти мышиные модели для поиска теста раннего обнаружения», — говорит Ральф Хрубан из Школа медицины Университета Джона Хопкинса, Балтимор.

Бернс, который использовал условные мутации для моделирования рака легких у мышей, говорит, что «серьезный шаг» в использовании таких систем продвинул технологию дальше с помощью временных и спорадических переключений, которые более точно имитируют онкогенез. «Может быть очень существенная разница между целой тканью, [которая] экспрессирует РАС, или несколькими клетками, которые экспрессируют РАС, в среде, где большинство клеток нормальное, и где есть нормальная передача сигналов», — объясняет он. Бардизи говорит, что будущие исследования будут способствовать дальнейшему развитию Cre-опосредованной мутации за счет добавления большего количества нокаутов генов и нокаутов в смесь.«Доступность различных нокаутов гена-супрессора опухолей, которые мы также можем добавить в нашу модель … позволит нам фактически сравнить начало и клиническую картину этих опухолей, а также определить их роль в возникновении различных биологических особенностей болезнь «, — говорит Бардиси.

С Эйлин Констанс можно связаться по адресу [email protected]

Что означает звездочка Costco на ценнике?

The Conversation

Умный бетон может проложить путь для высокотехнологичных и экономичных дорог.

Мост Золотые Ворота в Сан-Франциско в среднем ежедневно посещает более 100 000 автомобилей.Фото Сакета Гаруды для Unsplash Каждый день американцы путешествуют по дорогам, мостам и шоссе, не задумываясь о безопасности или надежности этих конструкций. Тем не менее, большая часть транспортной инфраструктуры в США устарела, приходит в упадок и остро нуждается в ремонте. Из 614 387 мостов в США, например, 39% старше своего расчетного срока службы, в то время как почти 10% структурно дефектны, что означает, что они могут начать разрушаться быстрее или, что еще хуже, быть уязвимыми для катастрофического отказа.Стоимость ремонта и улучшения общенациональной транспортной инфраструктуры колеблется от почти 0 миллиардов долларов США до почти Смех полезен для вашего разума и тела — вот что показывают исследования https://theconversation.com/laughing-is-good-for-your-mind -and-your-body-heres-what-the-research-shows-145984 Пн, 22 февраля 2021 г., 00:53:05 +0000 tag: theconversation.com, 2011: article / 145984 Будь то в форме сдержанного хихиканья или полный рев, смех имеет много преимуществ для физического и психического здоровья.Джанет М. Гибсон, профессор когнитивной психологии, Гриннелл-колледж Трудно превзойти хороший смех с другом. Клаус Ведфельт / DigitalVision через Getty Images Веселье и приятные сюрпризы — а также смех, который они могут вызвать — добавляют текстуры ткани повседневной жизни. Эти хихиканья и хохот могут показаться просто глупыми отбросами. Но смех в ответ на забавные события на самом деле требует много работы, потому что он активирует многие области мозга: области, которые контролируют двигательную, эмоциональную, когнитивную и социальную обработку.Как я обнаружил, когда писал «Введение в психологию юмора», исследователи теперь ценят силу смеха для улучшения физического и психического благополучия. Физическая сила смеха Люди начинают смеяться в младенчестве, когда это помогает развивать мышцы и силу верхней части тела. Смех — это не просто дыхание. Он основан на сложных комбинациях лицевых мышц, часто связанных с движением глаз, головы и плеч. Смех — делая это или наблюдая — активирует несколько областей мозга: моторную кору, которая контролирует мышцы; лобная доля, которая помогает понять контекст; и лимбическая система, которая модулирует положительные эмоции.Включение всех этих цепей укрепляет нейронные связи и помогает здоровому мозгу координировать свою деятельность. Активируя нейронные пути эмоций, таких как радость и веселье, смех может улучшить ваше настроение и сделать вашу физическую и эмоциональную реакцию на стресс менее интенсивной. Например, смех может помочь контролировать уровень нейромедиатора серотонина в мозге, подобно тому, как это делают антидепрессанты. Сводя к минимуму реакцию вашего мозга на угрозы, он ограничивает выброс нейротрансмиттеров и гормонов, таких как кортизол, которые могут со временем изнашивать вашу сердечно-сосудистую, метаболическую и иммунную системы.Смех — своего рода противоядие от стресса, который ослабляет эти системы и повышает уязвимость к болезням. Ответить на шутку — это хорошая тренировка для вашего мозга. Томас Барвик / Стоун через Getty Images Познавательная сила смеха Хорошее чувство юмора и смех, который следует за ним, во многом зависят от социального интеллекта и ресурсов рабочей памяти. Смех, как и юмор, обычно возникает из-за осознания несоответствия или абсурда ситуации. Вам нужно мысленно разрешить неожиданное поведение или событие — иначе вы не рассмеетесь; вместо этого вы можете просто запутаться. Выявление намерений других и их точка зрения может повысить интенсивность смеха и веселья, которые вы испытываете. Чтобы «уловить» шутку или юмористическую ситуацию, вам нужно уметь видеть более светлую сторону вещей. Вы должны верить, что существуют и другие возможности, помимо буквального, — подумайте о том, чтобы вас развлекали комиксы с говорящими животными, как в «Дальней стороне». Социальная сила смеха Многие когнитивные и социальные навыки работают вместе, чтобы помочь вам отслеживать, когда и почему смех возникает во время разговора.Вам даже не нужно слышать смех, чтобы смеяться. Глухие подписанты акцентируют свои подписанные предложения смехом, как смайлики в письменном тексте. Смех создает узы и увеличивает близость с другими. Лингвист Дон Нильсен отмечает, что хихиканье и смех редко случаются в одиночестве, поддерживая их сильную социальную роль. С самого раннего возраста младенческий смех является внешним признаком удовольствия, которое помогает укрепить связь с опекунами. Позже это внешний признак понимания ситуации. Например, ораторы и комики пытаются рассмешить, чтобы аудитория почувствовала себя психологически ближе к ним, чтобы создать интимную близость. Практикуя немного смеха каждый день, вы можете улучшить социальные навыки, которые могут не прийти к вам естественным образом. Когда вы смеетесь в ответ на юмор, вы делитесь своими чувствами с другими и учитесь на рисках, что ваш ответ будет принят / разделен / доставлен другим людям и не будет отвергнут / проигнорирован / не понравится. В ходе исследований психологи обнаружили, что мужчины с личностными характеристиками типа А, включая конкурентоспособность и срочность во времени, обычно смеются больше, а женщины с такими чертами смеются меньше.Оба пола больше смеются с другими, чем в одиночестве. Смех имеет ценность на протяжении всей жизни. Стив Презант / The Image Bank через Getty Images Умственная сила смеха Исследователи позитивной психологии изучают, как люди могут жить осмысленной жизнью и процветать. Смех вызывает положительные эмоции, которые приводят к такому расцвету. Эти чувства, такие как веселье, счастье, веселье и радость, повышают устойчивость и развивают творческое мышление. Они повышают субъективное благополучие и удовлетворенность жизнью. Исследователи обнаружили, что эти положительные эмоции, испытываемые с юмором и смехом, коррелируют с пониманием смысла жизни и помогают пожилым людям сохранять доброжелательное отношение к трудностям, с которыми они сталкивались на протяжении всей жизни.Смех в ответ на развлечение — это здоровый механизм выживания. Когда вы смеетесь, вы относитесь к себе или к ситуации менее серьезно и можете чувствовать себя уполномоченным решать проблемы. Например, психологи измерили частоту и интенсивность смеха 41 человека в течение двух недель, а также их оценки физического и психического стресса. Они обнаружили, что чем больше вы смеялись, тем меньше сообщалось о стрессе. Не имело значения, был ли смех сильным, средним или слабым. Может быть, вы хотите воспользоваться некоторыми из этих преимуществ для себя — сможете ли вы заставить смех работать на себя? Все большее число терапевтов пропагандируют использование юмора и смеха, чтобы помочь клиентам укрепить доверие и улучшить рабочую среду; обзор пяти различных исследований показал, что показатели благополучия действительно улучшались после вмешательства смеха. Иногда это называется домашней игрой, а не домашним заданием, эти вмешательства принимают форму повседневных юмористических действий — окружают себя забавными людьми, смотрят комедию, которая заставляет вас смеяться, или записывают три забавные вещи, которые произошли сегодня. [Глубокие знания, ежедневно. Подпишитесь на информационный бюллетень The Conversation.] Вы можете практиковаться в смехе даже в одиночестве. Умышленно выберите точку зрения, которая ценит забавную сторону событий. Йога смеха — это техника использования дыхательных мышц для достижения положительных физических реакций естественного смеха с принудительным смехом (ха-ха-хи-хи-хо-хо).Несколько советов о том, как начать заниматься йогой смеха. Сегодня исследователи, конечно же, не смеются над его ценностью, но значительная часть исследований влияния смеха на психическое и физическое здоровье основывается на самооценках. Дополнительные психологические эксперименты со смехом или контекстами, в которых он возникает, скорее всего, подтвердят важность смеха в течение вашего дня и, возможно, даже предложат больше способов намеренно использовать его преимущества. Эта статья переиздана с некоммерческого новостного сайта The Conversation, посвященного обмену информацией идеи от академических экспертов.Его написала: Джанет М. Гибсон, Гриннелл-колледж. Подробнее: Как дела, ха-ха? LOL сквозь века Наука деконструирует юмор: что делает некоторые вещи забавными? Серьезно относиться к смешному: психологи считают юмор сильной стороной характера Джанет М. Гибсон не работает, не консультируется, не владеет акциями и не получает финансирование от какой-либо компании или организации, которая могла бы принести пользу. из этой статьи, и не раскрыл никаких соответствующих принадлежностей, кроме их академического назначения.

Гликозилирование легких цепей иммуноглобулинов широко распространено при болезни холодовых агглютининов | Кровь

Введение: Первичная болезнь холодовых агглютининов (ИБС) — редкое заболевание, на которое приходится 15% всех аутоиммунных гемолитических анемий.Он связан с лежащим в основе моноклональным белком, которым у большинства пациентов является каппа IgM. Белок IgM запускает опосредованный комплементом внесосудистый гемолиз. Основная патофизиология, с помощью которой аутоиммунный гемолиз влияет только на небольшую группу пациентов с моноклональным белком IgM, плохо изучена. Изменения в структуре IgM посредством посттрансляционных модификаций легких цепей (LC), таких как гликозилирование, обогащаются у пациентов с AL-амилоидозом, еще одним редким заболеванием, проявления которого обусловлены структурой белка. (Kumar S. et al Leukemia, 2017). Мы предположили, что наличие посттрансляционного гликозилирования является потенциальным механизмом, позволяющим белку IgM запускать опосредованный комплементом гемолиз при ИБС.

Методы: Образцы сыворотки пациентов, оцениваемых на наличие нарушений моноклональных белков, были проанализированы с помощью времяпролетной масс-спектрометрии с лазерной десорбцией и ионизацией на основе иммунообогащения на основе матрицы (MALDI-TOF-MS), называемой MASS-FIX. В это исследование были включены пациенты, у которых был основной моноклональный белок IgM, идентифицированный MASS-FIX с 23. 07.2018 по 14.05.2019.Гликозилированные ЖК были идентифицированы по сдвигу их молекулярной массы из-за добавленной молекулярной массы углеводов. Гликозилирование сравнивали у пациентов с IgM-ассоциированной ИБС и другими IgM-нарушениями.

Результаты: В исследование были включены 438 уникальных пациентов с моноклональным белком IgM, идентифицированным с помощью MASS-FIX. ИБС присутствовала у 3% (n = 14) пациентов. Первичным основным диагнозом у остальных пациентов была моноклональная гаммопатия неустановленной значимости (MGUS): 47% (n = 206), лимфоплазмоцитарная лимфома (LPL) / макроглобулинемия Вальденстрема (WM): 30% (n = 132), лимфома, отличная от LPL : 6% (n = 28), AL амилоидоз: 4% (n = 19), CLL: 4% (n = 18), криоглобулинемия: 2% (n = 10), множественная миелома: 2% (n = 9) и другие: 0.5% (n = 2)

Гликозилирование присутствовало у 7% (31/438) пациентов в этой когорте. Гликозилирование было значительно более распространенным у пациентов с ИБС, чем у других гаммопатий IgM (64% против 5%, p <0,001). ИБС присутствовала у 29% пациентов с гликозилированием и только у 1% пациентов без гликозилирования, p <0,001.

Характеристики заболевания пациентов с ИБС, включая пациентов с гликозилированными ЛК и без них, перечислены в Таблице 1. Не наблюдалось статистически значимых различий в характеристиках пациентов с ИБС с и без гликозилирования, хотя размер выборки был небольшим.Все пациенты (100%) имели моноклональный белок каппа IgM. Медиана M-spike составила 0,5 г / дл. Сопутствующим нарушением был IgM MGUS у 50% пациентов, LPL / WM у 29%, лимфома маргинальной зоны у 14% и неспецифическое B-клеточное лимфопролиферативное заболевание у 7% пациентов. Средний гемоглобин составлял 11,2 г / дл. У всех пациентов была характерная агглютинация эритроцитов на мазке периферической крови. Повышенный уровень ЛДГ и неопределяемый гаптоглобин наблюдались у 100% пациентов. Титр холодовых агглютининов был положительным (> 1:64) у 12 из 13 пациентов (85%), у которых он был протестирован. У оставшегося пациента титр 1: 8. Полиспецифический тест Кумбса / прямой тест на антиглобин (DAT) был положительным у 100% пациентов (n = 12 протестированных), и все пациенты, прошедшие тестирование с помощью моноспецифического DAT, имели антитела к C3 (n = 10). У одного пациента также были моноспецифические антитела против IgG. Переливания потребовались 21% пациентов. Другие клинические проявления включали акроцианоз у 43% (n = 6) и феномен Рейно у 50% (n = 7) пациентов соответственно. Лечение ИБС включало ритуксимаб со стероидами или без них у 50% (n = 7) пациентов, химиотерапию на основе ритуксимаба — у 29% (n = 4) пациентов, только наблюдение — у 21% (n = 3) пациентов.

Выводы: Модификация структуры иммуноглобулина IgM путем посттрансляционного гликозилирования LC значительно чаще встречалась у пациентов с ИБС по сравнению с другими моноклональными гаммапатиями IgM (64% против 5%, p <0,001). ИБС наблюдалась только у 1% пациентов без гликозилирования, в то время как одна треть пациентов с гликозилированием имела ИБС. Это новая находка. Поскольку MASS FIX в настоящее время обычно проводится для обнаружения моноклональных белков в нашем учреждении, наличие гликозилирования LC может дать диагностические подсказки и может стать потенциальной терапевтической целью в будущем.Для подтверждения этих результатов необходимы дальнейшие исследования с участием более крупных независимых групп пациентов.

* SS и DLM внесли равный вклад

Раскрытие информации

Мюррей: Сайт для привязки: Патенты и роялти: Патентные права США на масс-спектроскопию. Лицензионное соглашение с сайтом привязки, финансирование исследований. Dasari: Сайт для привязки: Патенты и лицензионные платежи: Патентные права США на масс-спектроскопию. Лицензионное соглашение с The Binding Site, финансирование исследований. Кумар: Celgene: Консультации, финансирование исследований; Янссен: Консультации, финансирование исследований; Такеда: Финансирование исследований. Dispenzieri: Janssen: Консультации; Pfizer: Финансирование исследований; Такеда: Финансирование исследований; Celgene: Финансирование исследований; Alnylam: Финансирование исследований; Intellia: Консультации; Akcea: Консультации. Герц: Спектр: Гонорар, финансирование исследований; Janssen: Honoraria; Celgene: Honoraria; Prothena: Honoraria; Ionis: Honoraria; Alnylam: Honoraria.

% PDF-1.3 % 68 0 объект > endobj 120 0 объект > поток application / pdf2013-11-09T05: 03: 46.153-08: 00 конечный поток endobj 69 0 объект > endobj 64 0 объект > endobj 63 0 объект > endobj 65 0 объект > endobj 35 0 объект > endobj 37 0 объект > поток HW [S: ~ WƲSm` & pA8 «ZvnKdǁ) uiG_. + EOZjdrЖ «= k ڲ 0 A-> Mp71» ЕСРЛЭ) {M’a2A + ˥o

Разрыв дицентрика при слиянии теломер

  1. Стефан Марканд1
  1. Commissariat à l’Energie Atomique, Direction des Sciences du Vivant / Institut de Radiobiologie Cellulaire et Moléculaire / Service Instabilité Génétique Réparation et Recombinaison / Laboratoire Télmère et Réparation du Chromosome, Fontenay-aux-roses 92260, Франция; и Национальный центр научных исследований, UMR217, Fontenay-aux-roses 92260, Франция

Аннотация

Ингибирование негомологичных концевых соединений (NHEJ) на теломерах гарантирует, что нативные концы хромосом не сливаются вместе. Но возникновение и последствия редких слияний теломер до конца не изучены. Примечательно неясно, происходит ли слияние теломер могут быть обработаны для восстановления концов теломер. Здесь мы обращаемся к поведению отдельных дицентриков, образованных слиянием теломер. в дрожжах Saccharomyces cerevisiae . Наш подход состоял в том, чтобы сначала стабилизировать и усилить слияние двух хромосом путем временной инактивации одной центромеры. Затем мы проанализировали разрыв дицентриков после реактивации центромеры.Неожиданно дицентрики часто ломаются на теломере. слияния во время прогрессии через митоз, процесс, который восстанавливает родительские хромосомы. Этот непредвиденный результат предполагает спасательный путь, способный обрабатывать слияния теломер и поддерживать ингибирование NHEJ на теломерах.

Ключевые слова:

Теломеры — это ДНК-белковые комплексы на концах линейных хромосом. Они решают проблему конца репликации, в результате чего от полуконсервативной репликации ДНК (Walmsley et al.1983; Грейдер и Блэкберн 1985; Шор и Бьянки 2009). Они также защищают нативные концы хромосом от восстановления повреждений ДНК и пути контрольных точек, которые действуют на сгенерированные концы. двухцепочечными разрывами (de Lange 2009). Эволюция решила эти проблемы по-разному у прокариот и эукариот. У некоторых бактерий и вирусов хромосомы линейны и имеют ковалентно закрытые шпильки на концах теломер. Репликация производит инвертированные повторы, которые преобразуются в две ковалентно закрытые шпильки с помощью специальной резольвазы (Aihara et al.2007). Другими словами, у этих прокариотических организмов разрыв слитых теломер является нормальной частью репликации хромосомы. и цикл сегрегации. У эукариот теломеры представляют собой стабильные открытые двунитевые концы. В большинстве случаев они показывают короткие 3 ‘ одноцепочечный выступ, и их последовательности состоят из ориентированного короткого G-богатого повторяющегося мотива (например, TG 1-3 в дрожжах Saccharomyces cerevisiae и TTAGGG у позвоночных). Повторяющиеся мотивы позволяют концентрировать специализированные белки, распознающие их и устанавливающие теломерные функции.

Одной из функций теломер у эукариот является предотвращение слияний за счет двухцепочечного разрыва негомологичного соединения концов (NHEJ). путь восстановления (Riha et al. 2006). Обычная роль NHEJ — соединить два конца двухцепочечного разрыва. NHEJ требует трех консервативных факторов: KU Белок, связывающий конец ДНК; комплекс Rad50 – Mre11 – Xrs2 NBS1 ; и лигаза 4 с ее кофакторами, Lif1 XRCC4 и Nej1 CERNU / XLF (Daley et al.2005; Callebaut et al. 2006; Deng et al. 2009; Расс и др. 2009; Xie et al. 2009 г.). Ингибирование NHEJ на теломерах обеспечивается белками, связанными с двухцепочечными теломерными повторами. В делении дрожжи Schizosaccharomyces pombe , белок Taz1 связывает теломерную ДНК и рекрутирует белок Rap1. И Taz1, и Rap1 необходимы для ингибирования NHEJ. (Феррейра и Купер, 2001; Миллер и др., 2005). У млекопитающих TRF2, ортолог Taz1, рекрутирует RAP1 в теломеры, и оба TRF2 и RAP1 устанавливают ингибирование NHEJ, вероятно, через несколько путей (van Steensel et al.1998; Smogorzewska et al. 2002; Челли и де Ланж 2005; Бэ и Бауманн 2007; Sarthy et al. 2009 г.). В S. cerevisiae белок Rap1 непосредственно связывает теломерные последовательности и устанавливает несколько параллельных путей для ингибирования NHEJ (Pardo and Marcand 2005; Marcand et al. 2008). Синергия между различными путями гарантирует, что слияние остается редкостью. В отсутствие теломер, опосредованных теломеразой удлинение, слияние происходит в основном между чрезвычайно короткими теломерами, как это наблюдается у дрожжей (Chan and Blackburn 2003; Mieczkowski et al.2003), растения (Heacock et al. 2004), черви (Lowden et al. 2008) и клетки человека (Capper et al. 2007). Однако частота слияния теломер в физиологическом контексте дикого типа еще неизвестна.

Слияние теломер между хромосомами приводит к образованию дицентрических хромосом, чьи ожидаемые пагубные последствия наблюдаются в несколько экспериментальных ситуаций. Например, ингибирование TRF2 в клетках человека приводит к образованию анафазных мостиков (van Steensel et al.1998). У мышей клетки печени с обширными слияниями теломер, вызванными потерей TRF2, не могут нормально проходить через анафазу (Denchi et al. 2006). У делящихся дрожжей, лишенных Taz1, и у почкующихся дрожжей с условным мутантом Rap1 слияние теломер вызывает некоторую гибель клеток. (Феррейра и Купер 2001; Пардо и Марканд 2005). Наиболее часто изучаемые дицентрики создаются перегруппировкой, индуцированной двухцепочечным разрывом, и впервые были описаны Барбара МакКлинток в 1940-х годах (McClintock 1941, 1942).Они образуют анафазные мостики, которые разрываются где-то между двумя центромерами, вызывая дальнейшие перестройки и геном. нестабильность, которая в конечном итоге приводит к гибели клеток (Bajer 1964; Mann and Davis 1983; Haber et al. 1984; Surosky and Tye 1985; Koshland et al. 1987; Hill and Bloom 1989; Kramer et al. 1994; Jannink et al. 1996) ; Lo et al.2002; Han et al.2009; Paek et al.2009; Pennaneach and Kolodner 2009). Механизм разрушения дицентрика неизвестен. Высокая эластичность митотических хромосом не предполагает простого механического резка под действием силы шпинделя (Marko 2008).

Интересно, что слияние теломер, которое происходит спонтанно в зародышевой линии, иногда может стабилизироваться. Пример в человеческом эволюция — это хромосома 2, которая возникает в результате слияния двух хромосом, различающихся у обезьян (Lejeune et al. 1973). Теломерные повторы «голова к голове» все еще присутствуют в точке слияния (IJdo et al. 1991), и одна центромера инактивирована (Avarello et al. 1992). Недавно отдельные слияния хромосом были выбраны из делящихся дрожжевых клеток с необратимой делецией центромеры. (Исии и др.2008 г.). Здесь мы обращаемся к поведению индивидуальных дицентриков, образованных слиянием теломер у S. cerevisiae . Наш подход заключался в том, чтобы сначала стабилизировать и усилить отдельные слияния двух хромосом путем временной инактивации одной из них. центромеры в клетках с частыми слияниями теломер с теломерами. Затем мы проанализировали разрыв дицентриков после реактивации центромеры. Неожиданно дицентрики часто ломаются при слиянии теломер.

Результаты

Подбор индивидуальных слияний теломер

Во-первых, нам нужен был новый инструмент для стабилизации и выбора индивидуальных слияний теломер.В S. cerevisiae центромера может быть частично инактивирована транскрипцией с индуцируемого галактозой промотора GAL1 , направленного к центромере (Hill and Bloom 1987). Инактивированная центромера отделяется от веретена. Когда транскрипция отключена, центромера быстро присоединяется веретено, и его функция восстанавливается (Tanaka et al. 2005). Инактивация центромер стабилизирует слияние хромосом. Кроме того, это создаст положительный выбор для сплавов, поскольку неправильная сегрегация неслитой ацентрической хромосомы будет иметь пагубный эффект на рост клеток, а слияние хромосом спасет нормальную сегрегацию и жизнеспособность (Ishii et al.2008 г.). Чтобы повысить строгость этого отбора, мы решили инактивировать центромеру хромосомы 6. Увеличение числа копий. этой хромосомы убивает клетки, вероятно, потому, что она несет ген TUB2 , кодирующий субъединицу β тубулина (Katz et al. 1990; Torres et al. 2007). В гаплоидном контексте неправильная сегрегация хромосомы 6 приведет к тому, что одна клетка потеряет хромосому, а одна клетка — две. копии, оба нежизнеспособны. Мы вставили промотор GAL1 с каждой стороны центромеры хромосомы 6 ( CEN6 ) (рис.1А). Как показано на фиг. 1B, рост на среде, содержащей галактозу, частично нарушается, когда один промотор присутствует на одной стороне CEN6 , и дополнительно подавляется, когда по одному промотору присутствует на каждой стороне CEN6 . На глюкозе транскрипция подавляется, и рост клеток нормальный. В этом исследовании мы решили использовать конструкцию с двумя GAL1 промоторов, поскольку он оказался более эффективным при инактивации CEN6 .

Рисунок 1.

Подбор индивидуальных слияний теломер. ( A ) Схематическое изображение хромосомы 6 S. cerevisiae . Y ‘представляют собой субтеломерные элементы размером от 5 до 7 т.п.н., присутствующие в одной-четырех копиях примерно половины концов хромосомы. Левый конец хромосомы 6 (TEL 6L) содержит по крайней мере один Y ‘и субтеломерный элемент X длиной ∼500 п.н., за которым следует ∼10 т.п. протянуть с гомологией с другими субтеломерными областями.Правый конец хромосомы 6 (TEL 6R) содержит элемент X, за которым следует уникальной последовательностью, не имеющей гомологии с остальной частью генома. ( B ) Потеря жизнеспособности клеток в ответ на инактивацию CEN6 путем транскрипции. Штаммы Lev554 ( CEN6 ), Lev1064 ( CEN6-pGAL1 ), Lev1211 ( pGAL1-CEN6 ) и Lev1212 ( pGAL1-CEN6-pGAL1 ) выращивали в течение ночи в среде, обогащенной глюкозой. -кратные серийные разведения, высеянные на синтетические среды, и инкубировали 3 дня (глюкоза) или 4 дня (галактоза) при 30 ° C.Мутация ade2-1 , присутствующая на этом фоне, заставляет клетки накапливать предшественники пурина, когда они начинают истощать аденин. из среды. Эти предшественники придают колониям красный цвет. Колонии с большой долей больных или мертвых клеток остаются белый. ( C ) Усиление слияний между теломерами Y ‘. Штаммы Lev1212 ( RAP1 ), Lev728 [ rap1- (Δ) ] и Lev730 [ rap1- (Δ) lif1-Δ ] экспоненциально росли в богатой глюкозой среде (expo.) и позволил достичь стационарной фазы через 6 дней (стат.). Слияния амплифицировали с помощью ПЦР из 28 и 32 циклов с отжигом двух праймеров на концах Y ‘. Геномная ДНК из клеток rap1- (Δ) в стационарной фазе была серийно разведена, чтобы обеспечить полуколичественную оценку относительной частоты слияния. и чувствительности метода. ( D ) Обнаружение с помощью саузерн-блоттинга слияний между теломерами Y ‘в клетках rap1- (Δ) в стационарной фазе.Геномную ДНК расщепляли XhoI, разделяли в 0,9% агарозном геле и зондировали дистальным концом Y ‘. фрагмент. Маркер размера на слева находится в парах оснований. Средняя длина теломер в rap1- (Δ) клетках составляет ∼240 п.н .; то есть на ~ 60 п.н. короче, чем в клетках дикого типа. Стрелка отмечает положение слияний теломер Y′ – Y ′. ( E ) Отбор выживших после инактивации CEN6 в клетках rap1- (Δ) в стационарной фазе (см. Материалы и методы).( F ) Количественная оценка относительной частоты выживших после инактивации CEN6 в трех независимых экспериментах.

Затем мы ввели эту условную центромеру в клетки, где слияние теломер с помощью NHEJ является частым, используя ранее описанный RAP1 условный аллель degron, названный rap1- (Δ) .В клетках rap1- (Δ) уровень белка rap1 снижается, и слияния накапливаются, когда клетки достигают стационарной фазы (Pardo and Marcand 2005). На рис. 1С показана амплификация слитых теломер с помощью ПЦР с двумя праймерами, отжигающимися на конце последовательностей Y ‘, субтеломерных Элементы, присутствующие на кончике примерно половины хромосомы, заканчиваются в S. cerevisiae (Louis and Haber 1992). Слияния легко амплифицируются из клеток rap1- (Δ) , которые достигли стационарной фазы, но не из клеток RAP1 или из клеток rap1- (Δ) lif1-Δ , дефектных по NHEJ.В клетках rap1- (Δ) , растущих экспоненциально, слияния появляются по крайней мере в 100 раз реже, чем в стационарной фазе. Слияние между теломеры также должны быть обнаружены с помощью саузерн-блоттинга, если их частота достаточно высока, метод, впервые использованный в клетках человека. (van Steensel et al. 1998). В дрожжах теломеры Y ‘обнаруживают консервативный сайт рестрикции XhoI на расстоянии от 850 до 900 пар оснований (п.н.) от начала. TG 1–3 теломерных повторов (рис. 1А). Рисунок 1D показывает, что в клетках rap1- (Δ) , которые достигли стационарной фазы, новый мазок обнаруживается примерно в два раза больше среднего размера теломерной клетки XhoI. рестрикционные фрагменты в этих клетках. Этот мазок не обнаруживается в клетках rap1- (Δ) lif1-Δ , дефектных по NHEJ. Интенсивность мазка составляет ~ 3% от сигнала от концов Y ‘, что позволяет предположить в среднем один слияние двух теломеров Y ‘в четверти или трети клеток rap1- (Δ) в стационарной фазе, предполагая случайное распределение в популяции.

Когда стационарные клетки rap1- (Δ) с условным CEN6 были распределены на планшетах, содержащих галактозу, выжившие после инактивации CEN6 появляются с частотой ∼0,2% (рис. 1E, F). Выжившие по крайней мере в 50 раз реже встречаются в клетках rap1- (Δ) , растущих экспоненциально и в клетках rap1- (Δ) lif1-Δ в стационарной фазе, что указывает на общую корреляцию между выжившими после инактивации CEN6 и присутствием слияний теломер в клетках до инактивации CEN6 . Поскольку S. cerevisiae имеет 16 хромосом, наша предыдущая оценка из рисунка 1D, согласно которой существует по крайней мере одно слияние в четверти стационарных клеток rap1- (Δ) , предсказывает, что около 3% клеток должны иметь слияние хромосомы 6. к другой хромосоме, предполагая, что шансы равны между все теломеры. Расхождение между этим простым предсказанием и наблюдаемой частотой выживания 0,2% предполагает, что, в неподвижных клетках rap1- (Δ) некоторые теломеры могут быть более подвержены воздействию NHEJ, чем теломеры хромосомы 6, или слияние двух концов хромосомы 6, не выбранный в анализе, может быть более частым, чем слияние хромосомы 6 с другой хромосомой.Кроме того, сплавы могут быть распределены между ячейками неравномерно.

Характеристика индивидуальных слияний теломер

Кариотип восьми индивидуальных клонов, выбранных на галактозе из неподвижных клеток rap1- (Δ) , анализировали электрофорезом в импульсном поле (фиг. 2A, левая панель). Во всех клонах хромосома 6, а также другая хромосома отсутствуют в исходном положении, и одна размер новой хромосомы близок к сумме двух отсутствующих хромосом.Например, в клоне II хромосомы 6 (∼270 kb) и 9 (∼440 kb) отсутствуют, а новая хромосома появляется между 670 и 750 kb, что указывает на то, что хромосомы 6 и 9 сливаются вместе. Гибридизация с зондом из хромосомы 6 показывает для каждого клона основной сигнал в положении новой хромосомы (рис. 2А, правая панель). Более слабые сигналы присутствуют в нативном положении хромосомы 6 и на участке около 550 т.п.н., что примерно вдвое превышает размер хромосома 6 (см. ниже).

Фигура 2.

Идентификация восьми индивидуальных слияний теломер. ( A ) Штаммы Lev1212 ( RAP1 ), Lev728 [ rap1- (Δ) ] и Lev730 [ rap1- (Δ) lif1-Δ ] выращивали в глюкозосодержащей синтетической среде, а клоны I –VIII, выбранный на галактозе из Lev728, выращивали в галактозосодержащих синтетическая среда. Хромосомы разделяли с помощью PFGE, метили бромидом этидия ( левая панель ) и зондировали фрагментом из хромосомы 6 ( правая панель ). Размер и положение исходных хромосом обозначены слева . Звездочкой отмечено положение слабой полосы ∼550 kb. ( B ) Обнаружение слияний с TEL 6R методом Саузерн-блоттинга. Геномную ДНК расщепляли XhoI, разделяли в 0,9% агарозном геле. и зондировали с помощью TEL 6R-специфического фрагмента.Маркер размера на слева находится в парах оснований. Звездочкой отмечено положение слабой полосы размером ∼4 kb. ( C ) Обнаружение слияний с теломерами Y ‘методом Саузерн-блоттинга. Геномную ДНК переваривали XhoI, разделяли в 0,9% агарозе. гель и исследовали дистальным фрагментом Y ‘. Маркер размера на слева находится в парах оснований. Средняя длина теломер в клетках rap1- (Δ) , выращенных в среде, содержащей галактозу, составляет ∼180 п.н. , что на ∼60 п.н. короче, чем в тех же клетках, выращенных в среде, содержащей глюкозу. средний (данные не показаны).

Чтобы дополнительно охарактеризовать индивидуальные слияния, мы сначала использовали сайт рестрикции XhoI, присутствующий на 1740 bp от TG 1-3 теломерных повторов на правом конце хромосомы 6 (TEL 6R) (Fig. 1A). В саузерн-блоте с зондом TEL 6R (рис. 2B) несколько клонов демонстрируют дискретную полосу в ~ 3 т.п.н. вместо теломерного мазка в ~ 2 т.п.н., что указывает на то, что правая теломера хромосомы 6 слит в этих клонах.Размер полос предполагает слияние с теломерами Y ‘. Слабый мазок тоже видны около 2 кб, а также две слабые дискретные полосы около 2 кб и около 4 кб (см. ниже). Те же образцы были дополнительно проанализированы. с помощью саузерн-блоттинга с XhoI и зондом Y ‘(фиг. 2C). Клоны со слиянием с участием TEL 6R демонстрируют ту же полосу размером ~ 3 т.п.н., наблюдаемую с зондом TEL 6R, подтверждая слияние между TEL 6R и теломер Y ‘в этих клонах. Другие клоны отображают новую дискретную полосу между 2 и 2.2 кб, что предполагает слияние между левым концом хромосомы 6 (TEL 6L) и другой теломерой Y ‘. Clone I отображает полосу размером более 4 КБ, предлагая слияние между TEL 6L и теломером X. Субтеломерные последовательности, прилегающие к слияниям, были подтверждены с помощью ПЦР с X и праймер Y ‘(клон I), с двумя праймерами Y’ (клоны II, III, VI и VIII) и с праймером TEL 6R и Y ‘(клоны IV, V, и VII) (данные не показаны).Слияния клонов III и VIII обнаруживают сайт рестрикции на стыке двух теломер, позволяя клонировать и секвенировать каждый теломер, участвующий в слиянии. Клон III объединил две теломеры 147 и 95 п. н. из TG 1-3 , а клон VIII слил две теломеры 159 и 152 п.н. (их последовательности показаны в материалах и методах). Таким образом, инактивация одной центромеры позволяет отобрать и размножить отдельные слияния теломер с теломерными теломерами «голова к голове». повторяется на стыке.Длина повторов в клонированных слияниях короче средней длины теломер в клетках rap1- (Δ) (∼240 п.н.). Одна из интерпретаций состоит в том, что слиянию теломер может способствовать кооперация снижения связывания Rap1. сайтов в самых коротких теломерах и частичной потере функции мутанта rap1- (Δ) (Pardo and Marcand 2005). Еще одно предубеждение, которое мы наблюдали среди большого пула выбранных слияний, заключается в том, что TEL 6L сливается чаще, чем TEL 6R, и что некоторые хромосомы сливаются с хромосомой 6 чаще, чем другие (например,g., хромосома 5) (данные не показаны). Опять же, возможно, что некоторые теломеры относительно более подвержены NHEJ, чем другие в стационарных клетках rap1- (Δ) . Ограничения организации хромосом в ядре также могут способствовать слиянию между более крупными теломерами. вероятно, будут временно взаимодействовать (Therizols et al. 2010).

Обрыв дицентриков, образованных слиянием теломер

Затем мы спросили, как слитые хромосомы ведут себя, когда функция CEN6 восстанавливается.Клетки, росшие экспоненциально в присутствии галактозы, переводили на среду, содержащую глюкозу, на один и два удвоения населения. Анализ кариотипа с помощью электрофореза в импульсном поле показывает два интересных явления (рис. 3А). Во-первых, дицентрики, образованные слитыми хромосомами, исчезают, когда клетки делятся на глюкозу. Это видно по этидию окрашивание бромидом, когда дицентрик не перекрывается с другой хромосомой, и методом Саузерн-блоттинга. Во-вторых, хромосома вновь появляется в положениях нативных хромосом, которые были слиты вместе в дицентриках.Это повторное появление видно окрашиванием этидием в положении хромосомы 6, а также в положениях хромосом 9, 10 и 14 для клонов II, VII и VIII соответственно. Саузерн-блоттинг подтверждает повторное появление хромосомы 6 в каждом клоне. Он также показывает повторное появление хромосомы 7 для клонов I и IV и хромосомы 5 для клонов III, V и VI. Это указывает на то, что поломка дицентрика часто происходит в месте слияния теломер, соединяющего две хромосомы, или рядом с ним.Следовательно, слияние теломер ведет себя как горячие точки, особенно склонны к поломке.

Рисунок 3.

Разрыв дицентриков, образованных слиянием теломер. ( A ) Клетки из клонов I – VIII экспоненциально выращивали в синтетической среде, содержащей галактозу (0), и переводили на содержащую глюкозу богатая среда для одного или двух удвоений популяции (1 и 2).( Верхняя панель ) Хромосомы, разделенные PFGE, были помечены бромидом этидия и последовательно зондированы фрагментами из хромосом. 6, 3, 7 и 5. Положение нативной и слитой хромосом обозначено на слева . ( B ) Количественная оценка относительных сигналов от дицентриков и неслитой хромосомы 6, наблюдаемых с помощью зонда на хромосоме 6 и из неслитой хромосомы 5 (клоны III, V и VI) или хромосомы 7 (клоны I и IV), наблюдаемых с зондами хромосомы 5 и 7 соответственно.Сигналы корректировали на сигнал от хромосомы 3 для каждой дорожки. Для каждой серии указанный процент является относительным. к сумме дицентрика и неслитой хромосомы 6 в клетках, выращенных в галактозе.

Для количественной оценки потери дицентриков и повторного появления хромосом в их естественных положениях, Саузерн-блот была повторно гибридизирована с зондом из хромосомы 3, сигнал которого использовался в качестве внутреннего контроля нагрузки (рис.3А). Скорректированные сигналы затем нормализовали до суммы сигналов дицентрика и нативной хромосомы. в клетках, растущих с галактозой (точка 0) (рис. 3Б). В среднем дицентрики падают с 93% ± 2% в галактозе до 57% ± 4% и 33% ± 4% после одного и двух удвоений глюкозы, соответственно. Доля незалитой хромосомы 6 увеличивается с 7% ± 2% в галактозе до 22% ± 4% и 31% ± 7% после одного и два удвоения глюкозы соответственно.Относительный сигнал, объединенный от неслитой хромосомы 7 в клонах I и IV и от неслитая хромосома 5 в клонах III, V и VI увеличивается с 10% ± 3% в галактозе до 24% ± 6% и 36% ± 7% после одного и того же два удвоения глюкозы соответственно. Эта количественная оценка показывает, что ~ 40% времени разрушения дицентриков восстанавливает хромосомы естественного размера.

Обрыв на ТЕЛ 6R

Мы воспользовались уникальной последовательностью возле TEL 6R, чтобы крупным планом рассмотреть слияния клонов IV, V и VII во время первые два подразделения после реактивации CEN6 (рис.4А). Видна потеря слияния на ~ 3 kb, а также появление мазка около 2 kb. Ширина мазка относительно узкие, предполагая, что разрыв происходит внутри теломерных повторов, а не в смежных субтеломерных последовательностях. Интенсивность дискретной полосы внутри мазка также увеличивается. Эта полоса может указывать на то, что поломка часто происходит на предпочтительном позиция; например, на стыке двух теломер. Альтернативное объяснение показано на рисунке 4B (Bateman 1975; Smith 2008). Разрыв может происходить случайным образом внутри теломерных повторов, но 5′-деградация может обнажить соединение как оцДНК, что может сворачиваются обратно на себя, образуя дискретную полосу размером ~ 2 kb. Если эту шпильку заполнить и перевязать, но не открыть, репликация во время следующего клеточного цикла создает дицентрическую изохроматиду, которая могла бы объяснить фрагмент XhoI размером ~ 4 т.п.н., а также ~ 550 т.п.н. полоса, обнаруженная с помощью зонда хромосомы 6 на хромосомах, разделенных электрофорезом в импульсном поле (рис.2А). Вызванный разрывом обмен между хроматидами при инвертированных повторах может также создавать дицентрическую изохроматиду (Grossi et al. 2001). Отметим, что полоса размером ~ 550 т.п.н. мигрирует немного быстрее, когда правая теломер хромосомы 6 участвует в слиянии. чем когда это левый теломер. Это может быть связано с различными формами геля во время электрофореза в импульсном поле. (Лаланде и др., 1987).

Рисунок 4.

( A ) Поломка на ТЕЛ 6р. Клетки из клонов III, IV, V и VII экспоненциально росли в синтетической среде, содержащей галактозу. (0) и переключились на богатую глюкозу среду для одного или двух удвоений популяции (1 и 2). Геномная ДНК была переварена с XhoI, разделенный в 0,9% агарозном геле, и зондирование с помощью TEL 6R-специфического фрагмента. Маркер размера на слева находится в парах оснований.Звездочкой отмечено положение слабой полосы размером ∼4 kb. ( B ) Модель разрушения и деградации для образования дицентрических изохроматид (Smith 2008). Слитые TG 1–3 повтора отмечены красным. ( C ) Модель крестообразного расщепления для образования дицентрических изохроматид (Лобачев и др. 2002). ( D ) Нестабильность слияния теломер в моноцентрическом контексте. Хромосомы были разделены PFGE, помечены бромидом этидия. ( левая панель ) и исследовали фрагментом из хромосомы 6 ( правая панель ).Положение собственных хромосом обозначено на слева . Звездочкой отмечено положение слабой полосы ∼550 kb.

Нестабильность слияния теломер в моноцентрическом контексте

Чтобы проверить, является ли остаточный уровень неслитой хромосомы 6 в галактозе следствием частичной активности CEN6 , мы сконструировали штамм rap1- (Δ) с двумя сайтами loxP в прямых повторах на каждой стороне CEN6 .Индукция рекомбиназы CRE удаляет CEN6 из хромосомы и позволяет выбрать оставшихся в живых, у которых хромосома 6 слита с другой хромосомой (см. Материалы и методы). На фиг. 4D показан пример четырех клонов cen6-Δ (α – δ) рядом с четырьмя другими клонами, где CEN6 инактивирован транскрипцией с двух промоторов pGAL1 (IX – XII). Клон δ представляет собой слияние теломер TEL 6R и Y ‘. Остальные семь представляют собой смесь TEL 6L и другой теломер Y ‘(данные не показаны).Гибридизация с зондом из хромосомы 6 показывает, что остаточный уровень неслитого хромосома 6 уменьшается примерно в три раза при удалении CEN6 по сравнению с тем, когда она инактивирована транскрипцией (рис. 4D). Это различие указывает на то, что CEN6 все еще иногда активен, когда транскрипция индуцируется с двух промоторов pGAL1 . Кроме того, стабильный уровень неслитой хромосомы 6 в отсутствие CEN6 , несмотря на его постоянный контрселектор, указывает на более низкую, но значительную нестабильность слияний теломер.Интересно, полоса ~ 550 т. п.н. все еще обнаруживается в клонах cen6-Δ . Эта нестабильность в моноцентрическом контексте может происходить из-за палиндромной структуры слияний теломер (Fig. 4C; Szostak 1983; Murray et al. 1988; Lobachev et al. 2002, 2007; Cote and Lewis 2008; Smith 2008).

Обрыв происходит во время митоза

В предыдущих экспериментах разрыв наблюдали в разрешающем состоянии мутанта rap1- (Δ) .Чтобы изучить дицентрики, образованные слиянием теломер в контексте, более близком к дикому типу, мы дополнили аллель rap1- (Δ) в клонах II, III, IV и VIII интегративной плазмидой, несущей копию RAP1 дикого типа. . Эта плазмида размером 8 т.п.н. интегрируется в локус URA3 на хромосоме 5, иногда в нескольких копиях. Изученные нами дицентрики отображают один (клоны III и VIII), два (клон II) или четыре (клон IV) копии RAP1 (данные не показаны) (также видно по увеличенной длине хромосомы 5 в клонах II и IV на рис. 5А). Комплементированные клетки росли экспоненциально в присутствии галактозы и переводились на глюкозосодержащую среду для одно и два удвоения популяции. В эксперименте, показанном на Фигуре 5A, дицентрики в клетках, дополненных RAP1 , падают в среднем с 96% ± 2% в галактозе до 58% ± 4% и 34% ± 5% после одного и двух удвоений глюкозы, соответственно. Доля неслитой хромосомы 6 увеличивается с 4% ± 2% в галактозе до 18% ± 5% и 28% ± 9% после одного и два удвоения глюкозы соответственно.Это неотличимо от разрыва, наблюдаемого ранее в клетках rap1- (Δ) . Этот результат не исключает вовлечения Rap1 в этот процесс, так как его функция все еще может быть эффективной в разрешающее состояние мутанта rap1- (Δ) .

Рисунок 5.

Разрыв дицентриков в клетках, дополненных RAP1 . ( A ) Клоны II, III, IV и VIII, трансформированные pRS306- RAP1 , экспоненциально росли в синтетической среде, содержащей галактозу (0), и переводили на содержащую глюкозу богатую среду для одно или два удвоения популяции (1 и 2). Хромосомы были разделены PFGE, помечены бромидом этидия ( левая панель ) и зондированы фрагментом хромосомы 6 ( верхняя правая панель ) и фрагментом хромосомы 3 ( нижняя правая панель ).Положения нативной и слитой хромосом обозначены справа . Сигналы корректировали на сигнал от хромосомы 3 для каждой дорожки. Для каждой серии указанный процент является относительным. к сумме дицентрика и неслитой хромосомы 6 в клетках, выращенных в галактозе. ( B ) Клетки, трансформированные pRS306- RAP1 и экспоненциально росшие в синтетической среде, содержащей галактозу, были синхронизированы в G1 с α-фактором (G1), высвобожденным в богатая среда, содержащая глюкозу, и либо блокируется в G2 / M с помощью нокодазола (G2 / M), либо может пройти митоз до быть заблокированным в следующем G1 с α-фактором (следующий G1). Хромосомы были разделены PFGE, помечены бромидом этидия ( левая панель ) и зондированы фрагментом хромосомы 6 ( верхняя правая панель ) и фрагментом хромосомы 3 ( нижняя правая панель ). Положения нативной и слитой хромосом обозначены справа . Сигналы корректировали на сигнал от хромосомы 3 для каждой дорожки. Для каждой серии указанный процент является относительным. сумме дицентрика и неслитой хромосомы 6 в клетках G1 в галактозе.

Затем мы рассмотрели разрыв дицентриков в клетках, дополненных RAP1 , в течение одного клеточного цикла. Клетки, выращенные с галактозой, были синхронизированы в фазе G1 с помощью α-фактора, а затем высвобождается из блока в среде, содержащей глюкозу. Клетки либо блокировались при переходе G2 / M нокодазолом, либо позволяли пройти митоз, пока они снова не будут заблокированы в следующем G1 α-фактором, который был добавлен обратно в среду. Как показано на рисунке 5B переход от G2 / M к следующему G1 необходим для разрушения дицентриков и восстановления хромосомы 6. Во время этого перехода разрушается примерно половина дицентриков (от 97% ± 1% в G1 и 88% ± 6% в G2 / M до 52% ± 4% в следующем G1), а часть сигнала снова появляется в положении хромосомы 6 (от 3% ± 1% в G1 и 3% ± 1% в G2 / M до 21% ± 6% в следующем G1). Таким образом, разрыв дицентриков при слиянии теломер требует прогрессии через митоз.

Восстановление от фьюзов

Чтобы проверить их способность восстанавливаться после разрушения, RAP1 -дополненные клетки, содержащие дицентрическую хромосому, были экспоненциально выращены в среде, содержащей галактозу, и размещены на глюкозосодержащих пластинах. В течение первых трех поколений на глюкозе отдельные клетки отделялись после каждого деление, если они не смогли пройти через цитокинез. Затем клетки оставляли на 3 дня при 30 ° C для образования колоний. В результат показан на рисунке 6А. Черный кружок указывает на отделенную клетку, которая не смогла дать начало колонии. Среди 48 исходных клеток от каждого клона, большинство (26–41 человек) образовали по крайней мере одну колонию. Однако летальность очень часта и, по-видимому, происходит случайным образом во время первые подразделения. Интересно, что кризис более острый для клонов II и III, и эта разница коррелирует с более низкая эффективность при разрыве при слиянии в течение одного клеточного цикла (рис.5Б). Кроме того, некоторые клетки потерпели неудачу при первом делении, возможно, из-за того, что дицентрик уже сломался и хромосома 6 был неправильно сегрегирован перед нанесением покрытия.

Рисунок 6.

Восстановление из фьюжн. ( A ) Клоны II, III, IV и VIII, трансформированные pRS306- RAP1 , росли экспоненциально в синтетической среде, содержащей галактозу.(Первое положение от слева от ) Для каждого клона 48 индивидуальных клеток высевали на богатую глюкозой среду. После каждого из трех первых дивизий клетки были разделены и перемещены в одну линию, как показано на схеме, если только они не прошли через цитокинез в течение нескольких часов. (То есть после первого деления одна ячейка осталась в первой позиции от слева , а другая ячейка была перемещена в пятую позицию от слева .После второго деления одна ячейка осталась в исходном положении, а другая ячейка была перемещена на третью или седьмую. положение от слева от соответственно и тд). Колонии фотографировали после инкубации в течение 3 дней при 30 ° C. Кружок указывает на наличие ячейки которые не смогли образовать колонию. 24 колонии, выбранные для анализа PFGE, пронумерованы красным. ( B ) Хромосомы из клонов II, III, IV и VIII, трансформированные pRS306- RAP1 , выращенные в синтетической среде, содержащей галактозу, и из Lev1212 ( RAP1 ) и выбранных 24 колоний, выращенных в богатой среде, содержащей глюкозу. были разделены PFGE, меченные бромидом этидия ( верхняя панель ) и исследовали с помощью фрагмента Y ‘( нижняя панель ).Изменения обозначены красными стрелками. В колонии № 1 хромосома 9 появляется в двух копиях. В колонии №5 родственник Сигнал Y ‘повышен для хромосомы 6 или 1 и для хромосомы 13 или 16. В колонии № 11 сигнал Y’ снижен для хромосомы 5 или 8. В колонии № 22 сигнал Y ‘хромосомы 14 повышен.

Кариотип 24 колоний, полученных из родословной, анализировали с помощью электрофореза в импульсном поле. Мы выбрали шесть независимых колонии для каждого дицентрика (фиг. 6А). В каждой колонии хромосомы, которые сформировали дицентрики, снова появляются в своих исходных положениях или очень близко к ним. Единственный Исключение составляет колония № 22, где хромосома 14 снова оказывается выше, чем ожидалось (рис. 6B). Еще одно интересное изменение наблюдается в колонии № 1, где хромосома 9 появляется в двух копиях. Кроме того, хромосома не участвующие в слиянии, увеличиваются в размере в колониях № 5 и № 16.Гибридизация с зондом Y ‘показывает, что число копий Y’ не изменилось, за исключением колоний № 5, № 11 и № 22 (рис. 6B, нижняя панель). Эти перестройки могут происходить из-за разрыва внутри субтеломерной последовательности, за которым следует разрыв, индуцированный разрывом. репликация с другим субтеломером.

Обсуждение

В этом исследовании мы заметили, что инактивация одной центромеры позволяет отобрать и размножить теломер лицом к лицу. слияния хромосом.Когда две центромеры функционируют, дицентрики часто ломаются при слиянии теломер во время прогрессия через митоз. Эта обработка восстанавливает обе хромосомы и позволяет клеточному клону восстановиться после слияния. Это показывает замечательную устойчивость генома. Это также предполагает наличие неожиданного пути восстановления, способного поддержать ингибирование NHEJ. на теломерах. Этот путь сделает возможным обратимость слияний теломер, обычную стратегию коррекции биологической функции.Его существование означало бы, что, несмотря на несколько механизмов, гарантирующих, что NHEJ между теломерами остается маловероятным, редкие слияния иногда встречаются в нормальных клетках. Возникновение слияния может быть значительным во время длительного состояния покоя в спорах или в стационарная фаза, но это еще предстоит определить.

В нашем анализе около 40% дицентриков регенерируют две родительские хромосомы после разрушения. Эта частичная эффективность вызывает летальность среди потомков первых делений после образования дицентриков, а иногда и изменения генома, приводящие к подвержен ошибкам. На рисунке 7 мы предлагаем сценарий, объясняющий, как клетка с дицентриком либо продолжает делиться, либо умирает, либо восстанавливается после слияния. В анафазе две центромеры каждой сестринской хроматиды могут мигрировать к одному и тому же полюсу, тем самым распространяя дицентрическую следующему поколению в двух потомках.В качестве альтернативы центромеры каждой сестринской хроматиды могут мигрировать в противоположные стороны. полюса, образующие два анафазных мостика. Разрыв двух мостиков при слиянии восстанавливает нормальный кариотип у двух потомков. (ситуация А). Разрыв одного моста при слиянии и обрыв другого моста вдали от слияния создает одно потомство. отсутствие фрагмента хромосомы, летальная ситуация в гаплоидах (ситуация B). Другое потомство может восстановить сломанную двухцепочечную заканчивается репликацией, индуцированной разрывом (Lydeard et al.2007; Smith et al. 2007), воссоздавая дицентрик, но с дополнительной копией одной хромосомы (как видно в колонии № 1 на рис. 6B). Этот исход был бы летальным, если хромосома 6 является дублированной хромосомой (Torres et al. 2007). Обрыв двух перемычек также может произойти вдали от места слияния, либо на той же стороне относительно слияния (ситуация C) или с противоположных сторон (ситуация D). В обоих случаях одно потомство пропускает один или два фрагмента хромосомы и поэтому становится нежизнеспособен.Другое потомство может также восстанавливать два сломанных двухцепочечных конца путем репликации, индуцированной разрывом. Fusion от NHEJ также может произойти. В ситуации D, если два разрыва происходят поблизости, сплавление двух сломанных концов путем однонитевого отжига воссоздает единственную копию дицентрика.

Рисунок 7.

Модель сегрегации и разрушения дицентрика в течение одного клеточного цикла, образованного слиянием теломер.Теломеры синим цветом, центромеры — красным. Предлагаемый сценарий описан во втором абзаце Обсуждения.

Было бы интересно понять, почему поломка расплавов не эффективнее. Возможно, что лаборатория Штамм, который мы использовали, немного потерял пригодность, и другие сорта окажутся более способными на это.Также возможно, что Механизм поломки, который по своей природе подвержен ошибкам, связан со стабильностью генома даже при отсутствии слияний. Компромисс установил бы эффективность на промежуточном уровне. Избыточность механизмов, созданных для предотвращения слияния теломер. может также способствовать эволюционному отклонению пути спасения. С другой стороны, мы не можем формально исключить, что функция при естественном отборе происходит не разрушение редких слияний теломер, а другие аварии, порождающие дицентрико-подобные ситуации, которые могут быть более частыми в клетках дикого типа; например, запутанные теломеры после репликации (Miller et al.2006; Rog et al. 2009 г.).

Механизм разрушения неизвестен, за исключением того, что он происходит в узкой горячей точке (рис. 4A). Эта функция поможет молекулярному пониманию процесса. Можно представить несколько рабочих моделей. Поломка на слияние может происходить во время анафазы, когда хроматин под натяжением может быть более восприимчивым к разрыву теломерной последовательности из-за своей структуры хроматина, другого уровня конденсации, наличия зазубрин или набора нуклеаз теломерными белками. Разрыв также может быть вызван цитокинезом, как это наблюдается для запутанных хромосом в Top2-истощенных. дрожжевых клеток (Baxter and Diffley 2008) и дицентриков, созданных перестройками, индуцированными двухцепочечным разрывом в растительных клетках (Bajer 1964). В этой модели слияние будет рекрутироваться в плоскость расщепления во время абсциссии и будет молчать для контрольной точки NoCut , которая задерживает цитокинез в ответ на отстающий хроматин (Norden et al. 2006; Mendoza et al. 2009).Было бы интересно выяснить, является ли палиндромная структура слияния и Rap1 или факторы, задействованные Rap1 важны для создания горячей точки для поломки. Наконец, еще не известно, является ли спасательный путь слияния теломер могли существовать у других эукариот. Недавно описанный термочувствительный аллель TRF2 может быть инструментом для решения этой проблемы. у млекопитающих (Konishi and de Lange, 2008). Понимание механизма разрушения дицентриков при слиянии теломер и его сохранения в процессе эволюции должно избавить больше информации о том, как клетки поддерживают стабильность генома.

Материалы и методы

Штаммы и плазмиды

Штаммы, использованные в этом исследовании, перечислены в таблице 1. Промоторы GAL1 были вставлены в CEN6 двумя последовательными ПЦР-опосредованными трансформациями с использованием pFA6a- Kan MX6 -pGAL1 и pFA6a- skHIS3 MX6 -pGAL1 плазмиды (Longtine et al.1998). Kan-pGAL1 был вставлен на расстоянии 11 пар оснований от левого края CEN6 . skHIS3-pGAL1 был вставлен на 81 п.н. от правой стороны CEN6 . Полученная последовательность окружающих CEN6 в KANr-pGAL1-CEN6-pGAL1-skHIS3 штаммов AAGGAGAAAAAACCCGGATCTCAAAATGATATTTCTTTT CATCACGTGCTATAAAAATAATTATAATTTAAATTTTTTAATATAAATATATAAATTAAAAATAGAAAGTAAAAAAAGAAATTAAAGAAAAAATAGTTTTTGTTTTCCGAAGATGTAAA ATAGGTTGAAAGTTAGAAATTAGTATTATAATAGCAAAAAAAATTTAAAGTTAGAAATTAGAATTTAAGGCTCTACACACGCATTTTGAGATCCGGGTTTTTTCTCCTT. Конец промоторов GAL1 подчеркнут; последовательность CEN6 выделена жирным шрифтом.

Таблица 1.

Штаммы дрожжей, использованные в этом исследовании

Сайты lox P вставляли в те же положения около CEN6 с помощью двух последовательных трансформаций, опосредованных ПЦР, с использованием плазмид pFA6a- klTRP1 MX6 и pFA6a- skHIS3 MX6. klTRP1 находится на левой стороне CEN6 внутри двух сайтов lox P, а skHIS3 находится справа от CEN6 за пределами двух сайтов lox P. Плазмида pRS315 -pGAL1-CRE была трансформирована в дрожжевые штаммы Lev1125 и Lev1126.

Плазмида pRS306- RAP1 (Pardo and Marcand 2005) была расщеплена NdeI перед трансформацией в дрожжевые клетки.

Амплификация слияний теломер-теломер с помощью ПЦР

Геномную ДНК получали перевариванием зимолиазой с последующей фенол-хлороформной экстракцией. Слияние теломер Y ‘было амплифицирован с помощью двух следующих 34-мер: 5’-GTCAGAAAGCCGGGTAAGGTATGACAGCGAGAGT-3 ‘; 5’-GTCAGAAAGCCGGGTAAGGAGTGACAGCGCGAGT-3 ‘.

Эти праймеры отжигаются с концом Y ‘элементов 15–20 п.н. из TG 1–3 повторов.Реакции ПЦР (30 мкл) содержали ~ 10 нг геномной ДНК, 1 × буфер для ГХ Phusion, 3% ДМСО, 200 мкМ каждого dNTP, 0,5 мкМ каждый праймер и 0,6 ед. Phusion Polymerase (Finnzymes). Условия: 30 секунд при 98 ° C, затем 28 или 32 цикла по 10 секунд при 98 ° C, 50 сек при 72 ° C и 5 мин при 72 ° C. Продукты (10 мкл) разделяли через 1% агарозный гель, содержащий 0,1 мкг / мл. бромид этидия, и флуоресценцию количественно оценивали с помощью тепловизора Typhoon.

Подбор индивидуальных сплавов

Штаммы Lev1212 ( pGAL1-CEN6-pGAL1 ), Lev728 [ pGAL1-CEN6-pGAL1 rap1- (Δ) ] и Lev730 [ pGAL1-CEN6-pGAL1 rap1- (Δ9015) lif1- нанесены штрихами на богатой глюкозой среде (YPD), а затем экспоненциально росли в YPD в течение 24 часов.Части культурам позволяли достичь насыщения через 6 дней. Клетки, растущие в геометрической прогрессии или в стационарной фазе, разводили с подходящей разведение на чашках с синтетической средой, содержащей 2% глюкозы, и на чашках с синтетической средой, содержащей 2% галактозы. Колонии подсчитывали после инкубации в течение 4 дней при 30 ° C. Выжившие из Lev728 в стационарной фазе были повторно разбиты на галактозу, содержащую пластинки синтетической среды и культивирование в жидкой синтетической среде, содержащей галактозу, при 30 ° C для дальнейшего анализа. Клоны оказался стабильным после нескольких повторных проб на пластинах с синтетической средой, содержащей галактозу. Устойчивый уровень неслитой хромосомы 6 также остается неизменным в галактозе (данные не показаны).

Были изучены кариотипы нескольких выживших из Lev1212 ( pGAL1-CEN6-pGAL1 ) и Lev730 [ pGAL1-CEN6-pGAL1 rap1- (Δ) lif1-Δ ]. Неожиданно они отображают нормальную хромосому 6 и две копии хромосомы 2 (данные не показаны).Хромосома 2 несет кластер генов GAL7 , GAL10 и GAL1 , продукты которых превращают галактозу в глюкозо-фосфат. GAL2 , кодирующий пермеазу галактозы, находится на другой хромосоме. Введение в Lev1212 и Lev730 дополнительной копии GAL7 , GAL10 и GAL1 на центромерной плазмиде значительно увеличивает частоту выживших на галактозе (данные не показаны). Это говорит о том, что два копии хромосомы 2 придают устойчивость к галактозе за счет увеличения дозировки GAL7 , GAL10 и GAL1 , что, в свою очередь, может снизить внутриклеточную концентрацию галактозы и частично снизить скорость транскрипции промоторов GAL1 восстановление функции CEN6 .

Штаммы Lev1125 и Lev1126 [ loxP-CEN6-loxP rap1- (Δ) ], трансформированные pRS315- pGAL1-CRE , были свежими штрихами на глюкозосодержащей синтетической среде без лейцина, а затем выращены до насыщения в YPD в течение 6 дней при 30 ° С.Клетки распределяли при соответствующем разведении на чашках с синтетической средой, содержащей 2% галактозу, без лейцина. Выжившие были повторно посеяны один раз на планшетах с синтетической средой, содержащей галактозу, без лейцина, и были проверены на потерю Ген klTRP1 , связанный с кассетой loxP-CEN6 на пластинах с синтетической средой, не содержащей триптофана. Затем потеря CEN6 была подтверждена с помощью ПЦР с праймерами, окружающими локус CEN6 .Присутствие слияния теломер-теломер у каждого индивидуального выжившего cen6-Δ определяли с помощью PFGE (фиг. 4D) и саузерн-блоттинга с XhoI и зондом Y ‘(данные не показаны). После нескольких перерывов в работе синтез оказался стабильным. Плиты YPD. Устойчивый уровень неслитой хромосомы 6 также остается неизменным (данные не показаны).

Клонирование и секвенирование теломер-теломер слияния

Слияния теломер в дрожжах иногда генерируют уникальные сайты рестрикции на стыках (Pardo and Marcand 2005).Слияние клонов III и VIII отображает сайты рестрикции HpyCh5V и RsaI соответственно. Эти слияния были усилены с помощью ПЦР и расщепления на их стыке, и каждая теломера была субклонирована и секвенирована. Реконструированная последовательность слияния из клона III отображает 147 и 95 п.н. TG 1-3 повторы: GTCAGAAAGCCGGGTAAGGAGTGACAGCGAGAGTAAAGATAGATGTGAAAAGTGTGGGTGTGGTGTGTGGGTGTGTGGGTGTGGGTGTGGGTGTGGGTGTGGTGTGGGTGTGGTGTGGGTGTGTGTGTGTGGGTGTGGTGTGGGTGTGGTGTGGGTGTGGTGTGGGTGTGGGTGTGGTGTGTGTGTGGGTGTGGTG TGCA CCACACCCACACACACACACCCACACACCACACCCACACACCACACCACACACCACACCACACACCACACCACACCCACACACCCACACACACTTTTCACATCTACCTCTACTCTCGCTGTCATACCTTACCCGGCTTTCTGAC.

Реконструированная последовательность слитого из клона VIII дисплеи 159 и 152 п.н. TG 1-3 повторов: GTCAGAAAGCCGGGTAAGGAGTGACAGCGCGAGTAAAGGTAAATGTGAAATGTGTGTGTGTGTGGGTGTGTGGGTGTGGGTGTGGGTGTGGTGTGTGGGTGTGTGGGTGTGGTGTGTGTGGTGTGGGTGTGGTGTGTGGTGTGTGTGGGTGTGGTGTGGTGTGGTGTGTGGGTGTGTGTGGGTGTGGGTGTGGTGTGTGTGGGTGTG GTAC CCACACACCACACCCACACCCACACACCCACACCCACACCCACACCCACACACCACACCCACACCCACACACCACACCCACACACCACACCCACACACCACACCACACACCACACCACACACCACACCACACCCACACACCCACACACACTTTTCACATCTACCTCTACTCTCGCTGTCATACCTTACCCGGCTTTCTGAC.

Праймеры Y ‘, используемые для амплификации, подчеркнуты. Жирным шрифтом выделены сайты HpyCh5V и RsaI.

PFGE

Дрожжевую ДНК, внедренную в агарозные пробки, получали следующим образом: Около 10 9 клеток дважды промывали 1 мл 50 мМ ЭДТА, 10 мМ Трис (pH 7,5) (или 1 мл 1% Тритона, 250 мМ ЭДТА, 10 мМ Трис при pH 7.5 для клеток, арестованных в G1 или G2 / M) (фиг. 5B) и ресуспендировали в 150 мкл 50 мМ ЭДТА, 10 мМ Трис (pH 7,5). К суспензии добавляли зимолазу (0,6 мкл при 20 мг / мл), который быстро нагревали до 42 ° C и смешивали с 250 мкл предварительно нагретого 1% LMP агарозы и 125 мМ EDTA. Подвеска была распределена в лунки объемом 80 мкл, помещенные на прохладную поверхность. Пробки экструдировали и инкубировали в течение 24 ч при 37 ° C в 1,5 мл 500 мМ EDTA. и 10 мМ Трис (pH 7.5) с последующими 24 ч при 55 ° C в 1,25 мл 500 мМ ЭДТА, 10 мМ Трис (pH 8,0), 1% N-лаурилсаркозила и 0,4 мг / мл протеиназы К. Пробки промывали в течение 1 ч трижды по 1 мл 50 мМ ЭДТА и 10 мМ Трис (pH 7,5). Импульсное поле электрофорез проводили в 1% -ном агарозном геле в 0,5 × TBE при 14 ° C с помощью CHEF DRII от Bio-Rad со временем переключения 60 секунд в течение 15 часов, затем 90 секунд в течение 9 часов при 200 В.

Саузерн-блот

Зонды для саузерн-блотов представляли собой продукты ПЦР, амплифицированные из геномной ДНК дрожжей и очищенные в геле.Хромосома 6 представляет собой фрагмент размером 2,7 т.п.н. из координат 72471–75177 на левом плече хромосомы 6. Зонд Y ‘представляет собой фрагмент размером 0,85 т.п. н. от дистального конца элемента Y ‘(например, координаты 52–893 хромосомы 8). Зонд TEL 6R представляет собой фрагмент размером 0,6 т.п.н. из координаты 268971–269589 хромосомы 6. Зонд хромосомы 3 представляет собой фрагмент размером 2,4 т.п.н. из координат 138842–141231 хромосомы. 3. Зонд хромосомы 7 — 2.Фрагмент размером 3 т.п.н. из координат 14451–16729 хромосомы 7. Зонд хромосомы 5 имеет размер 2,1 т.п.н. фрагмент с координатами 113034–115142 хромосомы 5.

Благодарности

Мы благодарим Джули Купер за очень плодотворные обсуждения этого проекта, а также Офера Рога, Фрэнка Ульмана, Мадалену Тарсунас, Рэйчел Лескасс, Сержу Ганглофф, Сильвен Гаспарини, Деванши Джайн и Лауре Сабатье за ​​предложения и комментарии. Этот работа поддерживается грантами от ARC и ANR (ANR-06-BLAN-076).

  • Авторские права © 2010, Лаборатория Колд Спринг Харбор Пресс

Мичиганские росомахи связываются со спартанцами штата Мичиган и находят себе место в студенческом футболе. Bottom 10

The Bottom 10 вдохновляющих мыслей недели:

Я устал.
Устали играть в игру.
Разве это не стыдно?
Я так …
Посмотрим правде в глаза … все ниже пояса капут!

— Лили фон Штупп, «Сверкающие седла»

Хэллоуин уже здесь. Октябрь скользит в зеркало заднего вида. Глаз черный размазан. Столы тренеров заполнены. Холодные ванны упакованы. Как и джакузи. Настроение уже не на высоте. Они сломаны. Перспективы больше не оптимистичны. Они реалистичны. И с каждым часом выходных, рядом с названием еще одного университета появляется еще одна звездочка «Не годен для постсезона».

Есть старая тренерская поговорка: они помнят, что ты делаешь в ноябре. Это никогда не было так актуально, как сейчас, поскольку комитет плей-офф колледжа футбола собирается за закрытыми дверями в шикарном отеле Даллас-Форт-Уэрт Metroplex, чтобы определить 25 лучших команд в игре.

Но это не то, как мы попадаем в нижнюю десятку. Наша отборочная комиссия собирается в кирпичном навесе за мотелем Dream Lodge недалеко от Мескита. Наша еда не обслуживается. Мы едим из детского меню Whataburger. И вместо того, чтобы получать бесконечные цифровые данные со статистикой с точностью до секунды от Power 5, у нас есть одна из тех старых тикерных лент из закрытой закрытой газеты, которая беспощадно забирает данные с MAC East, Sun Ремень и AACACCACAA.

Это гламурно? Нет. Но разве это необходимо? Вообще-то нет. Но мы все равно это делаем. Как бы мы ни устали.

Приношу свои извинения Стиву Харви и уважаемому губернатору Уильяму Дж. Лепетоману, вот и последняя десятка этой недели. Кто-то должен вернуться и получить кучу десятицентовиков.

1. СМУ (0-7)

Реальная история. На прошлой неделе я был в Далласе, работал над историей для журнала ESPN The Magazine, и у меня было несколько часов, чтобы убить. Так что я поехал в SMU, нашел открытые ворота и пошел на стадион Джеральда Форда.Внизу на поле горстка легкоатлетов, сделавших бег на короткие дистанции, бросала найденный футбольный мяч. Охранник, собираясь вежливо попросить меня уйти, поприветствовал меня улыбкой, сказав: «Это лучшее нарушение, которое я видел на этом поле за весь год».

2. Штат Джорджия (1-7)

Южная Джорджия, нет, постой … Я имею в виду, штат Джорджия, отстал от штата Джорджия … То есть Южная Джорджия, но потом Южная Джорджия … Я имею в виду , Штат Джорджия, сплотились, чтобы закрыть его.Но, в конечном итоге, штат Джорджия … Я имею в виду, что Джорджия Саутерн оказалась слишком талантливой и поставила Джорджию Саутерн … Я имею в виду, штат Джорджия, проигравшую со счетом 69-31. Когда скандируют «ГСУ!» Начался во втором тайме, честно говоря, мне стало легче. Или хуже.

3. Штат Кент (1-7)

Интересный факт: сейчас шесть команд во всем футбольном клубе FBS имеют одну из звездочек дисквалификации после окончания сезона из-за того, что уже понесли семь поражений. Половина этих команд находится на Востоке MAC.

4. Троя (1-7)

Троя компенсировала свою потерю Аппалачскому штату потерей Южной Алабамы. Говоря об Аппалачах, я хочу вкратце сказать всем фанатам Mountaineers, которые заполнили мой почтовый ящик жалобами на то, что я продолжал называть их Appy State. Потому что, знаете ли, это самая большая проблема, с которой они сейчас сталкиваются … получить глупое прозвище, как и любой другой команде в этом совершенно вымышленном рейтинге. Это что-то обо мне и фан-базах бывших центров влияния Южной конференции…

5. Мичиган (3-5)

Вставляя шип в газон, как будто вы владеете этим местом в 3-4 года (примерно 3-5 лет), вы потеряли четыре из прошлых пять в серии, и вы не побеждали на «Спартанском стадионе» со времен администрации Буша? Это все равно, что войти в байкерский бар и сказать кому-то выйти наружу в шортах-бермудских шортах и ​​сандалиях с носками. В соответствующей заметке рассерженные после спайка Марк Дантонио и KISS Том Иззо должны зарегистрироваться, чтобы сразиться за титул команды на следующей WrestleMania.

6. Вандербильт (2-6)

Дорез выиграли серию из двух игр против Чарльстона Южного и Университета Открытой даты, но проиграли Миццу в турнире Dear Heavens. Спасибо, что мы не в The SEC West Classic. Джонни МакКрари забросил на 196 ярдов, а это означает, что Ванди теперь лидирует по желанной статистике «Количество QB, которые бросили на 200-400 ярдов за сезон» — четыре.

7. UConn (1-6)

Snow Dogs устроили энергичную борьбу против Восточной Каролины, но не смогли внести хаос в естественный порядок Американской атлетической конференции американской легкой атлетики.

8. Талса (1-6)

«Золотой ураган» дал мне немного времени, он же «Время Талсы», чтобы освежить свои силы для поездки в Мемфис на этих выходных. Я бы посоветовал им зайти в Грейсленд, чтобы поесть жареного арахисового масла и сэндвичей с нана. Они будут нуждаться в таком мужественном топливе перед встречей с SMU 8 ноября. Честно говоря, разве это не должно было быть назначено на Хэллоуин?

9. Восточный Мичиган (2-6)

Больной MAC Восток, захватывающий все внимание, въехал член западного подразделения.Это сводилось к подбрасыванию монеты между «Мальчиками из Упсиланти». которые понесли подряд поражения от UMass и Северного Иллинойса, а также от Айдахо, который выиграл у Fighting Byes of Open Date со счетом 0: 0. Но монета, которую я подбросил, покатилась под моим диваном и потерялась в реестре кондиционеров, так что … Это Восточный Мичиган! В течение следующих четырех недель Восточный Мичиган, Центральный Мичиган и Западный Мичиган будут играть друг с другом.

10. Уэйк Форест (2-6)

В перерыве между окончательным поражением Бодэциса Бишопс от Бостонского колледжа я прижал футбольный мяч к спине моей собаки, и она перебежала кухню.Затем я угостил ее и сообщил, что теперь у нее было больше нарушений, чем было у «Неистовых братьев» — шесть ярдов — за две четверти футбола.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *