Антибиотик против гриппа и орви: Аптека Ригла – забронировать лекарства в аптеке и забрать самовывозом по низкой цене в Москва г.

Содержание

«Какие антибиотики для лечения гриппа?» – Яндекс.Кью

Антибиотики при «гриппе», а так же при ОРВИ не назначают. Это связано с тем, что все антибактериальные препараты не эффективны в отношении вирусов (они «убивают» только бактерии). Применение антибиотиков при «гриппе» может быть опасно из-за развития побочных эффектов (в первую очередь влияние на желудочно-кишечный трак и нарушение стула), а формирования устойчивости микробов к данной группе препаратов (в дальнейшем этот антибиотик может быть не эффективен при лечении бактериальных заболеваний).

Как правило, при установленном диагнозе «грипп» назначается:

1) Противовирусный препарат Тамифлю или Реленза (препятствуют размножению вируса в организме). Важно подчеркнуть, что если диагноз «грипп» не подтвержден и у пациента симптомы ОРВИ, то данные препараты не будут эффективны (это связано с особенностями «жизнедеятельности» различных вирусов)

2) при повышении температуры тела выше 37. 5 — жаропонижающие средства

(Аспирин, Нурофен, Парацетамол). При приеме жаропонижающих средств нельзя превышать разрешенные дозировки, в случае Парацетамола не более 4 гр в сутки и не более 1 гр за один прием.

3) при явлениях сухого кашля может быть рекомендован прием препарата Ренгалин.

Важно подчеркнуть, что устанавливает диагноз врач и он должен рекомендовать правильную схему лечения. Избегайте «самолечения» и лечения «в аптеке» по рекомендации фармацевта так как каждый препарат имеет свои противопоказания и побочные эффекты. При повышении температуры тела или развитии других симптомов необходимо получить консультация врача-терапевта.

Так же важно соблюдать ряд общих рекомендации для ускорения процесса выздоровления:

  • обильное питье — 40 мл на 1 кг массы тела в сутки
  • соблюдение постельного режима на весь период повышения температуры.
  • регулярное проветривание помещения, по возможности проведение в помещении влажной уборки.
    Пациент при этом должен находиться в другой комнате, чтобы избежать переохлаждения.
  • до момента исчезновения жалоб и нормализации температуры тела Вы можете быть источником инфекции, поэтому при контакте с окружающими необходимо носить индивидуальную маску. Отмечаю, что маску необходимо менять каждые 2-3 часа.

Профилактика ОРВИ и Гриппа

В разгар инфекции ОРВИ и ГРИППА населению рекомендуется:

- ограничить посещение массовых мероприятий, особенно в закрытых помещениях,

- использовать средства индивидуальной защиты (маски),

- избегать слишком тесного контакта с больными,

- как можно чаще мыть руки с мылом, после посещения общественных мест, перед приемом пищи,

- регулярно проводить влажную уборку в помещении, часто проветривать,

- чаще бывать на свежем воздухе, правильно организовать рациональный режим питания, труда и отдыха.

Существует несколько мифов и фактов о гриппе

  1. ВИРУС ГРИППА НЕ БОИТСЯ МОРОЗА

При температуре около нуля вирус сохраняется до месяца. Именно поэтому пик заболеваемости приходится на оттепели. Зато обычное мыло убивает вирус, так же действуют на вирус гриппа высушивание и температура выше 70 С.

  1. АСПИРИН ПРИ ГРИППЕ МОЖЕТ ПРИВЕСТИ У СМЕРТИ, ОСОБЕННО ДЕТЕЙ

При сочетании вирусной инфекции и ацетилсалициловой кислоты, входящей в состав аспирина и некоторых других препаратов, может развиться тяжелое состояние – синдром Рея.

  1. ВО ВРЕМЯ ЧИХАНИЯ И КАШЛЯ ЧАСТИЧКИ СЛЮНЫ С ВИРУСОМ ГРИППА РАЗЛЕТАЮТСЯ СО СКОРОСТЬЮ 16 км/час.

Миф о том, что инфекция распространяется быстрее – 180 км/час, не был научно подтвержден. Результаты работы были опубликованы в журнале PLOS ONE.

  1. ЛЕЧИТЬ ГРИПП БЕССМЫСЛЕННО: БОЛЕЗНЬ НЕ ОПАСНА И ПРОЙДЕТ САМА СОБОЙ.

Грипп очень опасен. Заболевание гриппом может закончиться летальным исходом, особенно у маленьких детей и пожилых людей. Кроме того, болезнь может оставлять после себя различные осложнения. Чаще всего грипп действует губительно на сердечно-сосудистую систему, сокращая на несколько лет продолжительность жизни.

Ироничное высказывание «без лечения грипп длится неделю, а с лечением семь дней» содержит долю правды. Но только не в том случае, если лечение начато вовремя. Своевременность лечения не только сократит сроки болезни, но и уменьшит вероятность развития осложнений.

  1. МОЖНО ЛИ ЛЕЧИТЬ ГРИПП АНТИБИОТИКАМИ?

Антибиотики действуют только на бактерии.

Вирусы ничего общего с бактериями не имеют, следовательно, лечить антибиотиками вирусные заболевания, в том числе, грипп, бесполезно. Иногда на фоне ослабленного иммунитета к вирусной инфекции может присоединиться вторичная бактериальная инфекция. И только в такой ситуации врач (и только врач!) может назначить курс антибиотиков.

  1. ЧТОБЫ НЕ ЗАБОЛЕТЬ ГРИППОМ, ДОСТАТОЧНО ПРИНИМАТЬ ВИТАМИНЫ И ЕСТЬ БОЛЬШЕ ЛУКА, ЧЕСНОКА, КВАШЕНОЙ КАПУСТЫ И ЛИМОНОВ.

Витаминная профилактика носит общеукрепляющий характер и непосредственно на вирус не действует. Оптимальным решением станет комплексная профилактика, которая предусматривает закаливание, иммуностимулирующие препараты, вакцинацию и, конечно, витамины.

  1. ПРИВИВКА ОТ ГРИППА НЕ ДАЕТ СТОПРОЦЕНТНУЮ ГАРАНТИЮ.

Риск заражения гриппом после прививки остается, но существенно снижается. В среднем прививка обеспечивает защиту на 80-90%.

  1. ВИРУСЫ ГРИППА ПОСТОЯННО МУТИРУЮТ. ЗНАЧИТ НЕВОЗМОЖНО ПРЕДУГАДАТЬ, КАКОЙ ИЗ НИХ БУДЕТ В «МОДЕ» И СОЗДАТЬ ВАКЦИНУ, ЗАЩИЩАЮЩУЮ ИМЕННО ОТ НЕГО?

Всемирная Организация Здравоохранения постоянно исследует перемещение вирусов по всему миру и на основании этих исследований дает предложения разработчикам вакцин. Даже если прогноз не оправдался на 100%, вакцина все равно действует, так как большинство вирусов гриппа имеют общие антитела.

Врач-эпидемиолог Дмитриева Е.С.​

Грипп/простуда

Категория: Здоровье от «А» до «Я».

Самые популярные мифы о гриппе

Об этом распространенном заболевании и вакцинации против него существует множество разнообразных мнений и убеждений. Но они далеко не всегда являются фактами. Мифы о гриппе окружают нас. Ошибочное представление об этом заболевании распространено даже среди самих медиков. Пришло время расставить точки над «и».

Грипп неприятное, но не опасное заболевание

На фоне такой смертельно опасной инфекции с большим числом летальных исходов, как свиной грипп, обычный сезонный грипп кажется чем-то незначительным. Но это не так. Самочувствие больных отвратительно: жар, кашель, ломота и боль во всем теле. У гриппа могут быть и серьезные последствия. Согласно статистике, от этого вируса умирает 36 тыс. человек в год, а это сопоставимо со смертностью от рака груди среди женщин и более чем в два раза превышает число погибших от СПИДа.

Свиной грипп передается через свинину

Очень многих вводит в заблуждение название этого заболевания. В качестве профилактики люди отказываются от употребления в пищу свинины. К сожалению, это не эффективно, так как свиной грипп не передается через мясные продукты.

Вакцина от гриппа может стать причиной заражения

Этот миф способен вывести из душевного равновесия любого врача. Дело в том, что в состав вакцин входят убитые вирусы, которые просто не способны стать причиной развития инфекции. Однако данное заблуждение очень сложно искоренить. Врачи объясняют это тем, что вакцинированные люди путают грипп с побочными эффектами вакцинации. Второй причиной стойкости этого мифа является частое заражение другими, не имеющими ничего общего с гриппом инфекциями.

Не существует лекарств от гриппа

Для лечения гриппа разработана высокоэффективная противовирусная терапия. Кроме того, проводят активацию иммунной системы, стимулируя собственные защитные механизмы организма. И хотя быстро вылечить грипп довольно сложно, корректная терапия помогает избежать осложнений и сократить время болезни на несколько дней.

Антибиотики могут вылечить грипп

Антибиотики назначают только при наличии бактериальной инфекции. Грипп — вирусное заболевание, поэтому эти препараты в данном случае абсолютно неэффективны. Очень часто врачи сталкиваются с тем, что пациенты требуют назначения антибиотиков либо принимают их без консультации врача. Если врачи назначают антибиотик при гриппе, они делают это потому, что одно из серьезных осложнений гриппа — развитие вторичной бактериальной инфекции (что происходит довольно часто, так как вирусное заболевание ослабляет иммунную систему, и организм не может противостоять бактериям), которая, в свою очередь, может привести к развитию отита, бронхита, синусита или пневмонии. Если в прошлый раз для лечения осложнений врач прописал вам антибиотики, это еще не повод принимать их для профилактики в следующий раз. Частый прием антибиотиков может развить устойчивость к ним.

Грипп опасен только для пожилых

Большинство людей считают, что грипп тяжело переносят (или даже умирают) только пожилые люди, в возрасте старше 65 лет. Но грипп угрожает тяжелыми осложнениями пациентам любого возраста. Наиболее восприимчивы к заражению маленькие дети. Особенно большой процент госпитализации наблюдается среди детей младше двух лет. Кишечный грипп — один из видов обычного гриппа Название «грипп» используется в обозначениях многих заболеваний. Действительно, существует вирус, поражающий желудочно-кишечный тракт. Он называется кишечным гриппом, но не имеет никакого отношения к острым респираторным вирусным инфекциям. Если вас мучает тошнота и диарея, но совершенно не беспокоит жар, то, скорее всего, гриппа у вас нет.

Нельзя дважды заболеть гриппом

Бытует мнение, что, заболев и вылечившись от гриппа один раз, вы не заразитесь повторно, а значит, нет необходимости в вакцинации. Это мнение ошибочно, так как вирус гриппа каждый год мутирует, и каждый новый штамм может вызвать инфекцию, несмотря на появившийся иммунитет к предыдущему типу. Не стоит пренебрегать вакцинацией, даже если вы уже переболели гриппом. Ведь если у вас выработался иммунитет к одному штамму, это не защищает вас от другого, который может таиться неподалеку.

Молодым и здоровым можно пропускать вакцинацию

Молодой возраст и хорошее здоровье могут гарантировать вам быстрое выздоровление и отсутствие осложнений, но никак не полную защиту от инфекции. Тем более целью вакцинации является не только самозащита. Не стоит забывать о здоровье своих близких, которые могут такой защитой и не обладать. Если с вами живет маленький ребенок или пожилой человек, вы сможете защитить их от заражения и тяжелых последствий, сделав прививку себе. Те же правила действуют и на глобальном уровне: чем больше людей иммунизировано против гриппа, тем меньше шансов развиться эпидемии.

Вакцинироваться можно не каждый год

Статистика показывает, что далеко не все проводят иммунизацию каждый год, полагая, что вакцина от гриппа действует несколько лет. Это не так. Каждый год распространяется новый штамм гриппа, отличающийся от прошлогоднего. Потому и вакцины год от года отличаются друг от друга.

Вакцинация опасна

Многие верят, что существует связь между вакцинами и развитием некоторых заболеваний у детей. Например аутизма. Но никаких подтверждений этому не существует.

Гриппом можно заболеть на холоде

Даже если вы всю зиму будете ходить без шапки, это не повысит риск заболеть гриппом. Если причиной простуды является переохлаждение, вероятность которого возрастает в осенне-зимний период, то пики заболеваемости гриппом зависят от цикла развития вируса. Низкая частота простудных заболеваний и регулярные эпидемии гриппа в теплых регионах страны доказывают это. В настощее время вакцинация от гриппа является лучшей профилактикой этого серьезного заболевания. И лучше ею не пренебрегать.

К оглавлению

Клинические рекомендации ОРВИ

Клинические рекомендации:

«Острая респираторная вирусная инфекция (ОРВИ) у детей . МКБ 10: J00 / J02.9/ J04.0/ J04.1/J04.2/J06.0/J06.9

Год утверждения (частота пересмотра): 2018 (пересмотр каждые 3 года)

Профессиональные ассоциации:  Союз педиатров России

Утверждены : Союзом педиатров России

Приложение В. Информация для пациентов

 

ОРВИ (острая респираторная вирусная инфекция) – наиболее часто встречающееся заболевание у детей.

Причина заболевания – разнообразные вирусы. Заболевание чаще развивается осенью, зимой и ранней весной.

Как заражаются инфекцией, вызывающей ОРВИ: чаще всего путем попадания на слизистую оболочку носа или конъюнктиву с рук, загрязненных при контакте с больным (например, через рукопожатие) или с зараженными вирусом поверхностями (риновирус сохраняется на них до суток).

Другой путь – воздушно-капельный – при вдыхании частичек слюны, выделяющихся при чихании, кашле или при тесном контакте с больным.

Период от заражения до начала болезни: в большинстве случаев – от 2-х до 7 дней. Выделение вирусов больным (заразность для окружающих) максимально на 3-и сутки после заражения, резко снижается к 5-му дню; неинтенсивное выделение вируса может сохраняться до 2 недель.

Признаки ОРВИ: наиболее частым проявлением ОРВИ у детей является заложенность носа, а также выделения из носа: прозрачные и/или белого и/или желтого и/или зеленого цвета (появление выделений из носа желтого или зеленого цвета – не является признаком присоединения бактериальной инфекции!). Повышение температуры чаще длится не более 3 дней, затем температура тела снижается. При некоторых инфекциях (грипп и аденовирусная инфекция) температура выше 38ºC сохраняется более длительно (до 5-7 дней).

При ОРВИ также могут быть: першение в горле, кашель, покраснение глаз, чихание.

Обследования: в большинстве случаев, дополнительных обследований ребенку с ОРВИ не требуется.

Лечение: ОРВИ, в большинстве случаев, носит доброкачественный характер, разрешается в течение 10 дней и не всегда требует назначения медикаментов.

 

Снижение температуры: лихорадящего ребенка следует раскрыть, обтереть водой Т° 25-30°С. С целью снижения температуры у детей допустимо применение только 2-х препаратов – парацетамола или ибупрофена. Жаропонижающие препараты у здоровых детей ≥3 месяцев оправданы при температуре выше 39 — 39,5°С. При менее выраженной лихорадке (38-38,5°С) средства, снижающие температуру, показаны детям до 3 месяцев, пациентам с хронической патологией, а также при связанном с температурой дискомфорте. Регулярный (курсовой) прием жаропонижающих нежелателен, повторную дозу вводят только после нового повышения температуры.

 

Чередование этих двух препаратов или применение их в комбинации не приводит к усилению жаропонижающего эффекта.

 

У детей с жаропонижающей целью не применяют ацетилсалициловую кислоту и нимесулид. Крайне нежелательно использование метамизола у детей в связи с высоким риском развития агранулоцитоза. Во многих странах мира метамизол запрещен к применению уже более 50 лет назад.

Антибиотики – не действуют на вирусы (основную причину ОРВИ). Вопрос о назначении антибиотиков рассматривается при подозрении на бактериальную инфекцию. Антибиотики должен назначать врач. Бесконтрольный прием антибиотиков может способствовать развитию устойчивых к ним микробов и вызывать осложнения.

Как предупредить развитие ОРВИ:

Заболевшего ребенка следует оставить дома (не водить в детский сад или школу). Первостепенное значение имеют меры, препятствующие распространению вирусов: тщательное мытье рук после контакта с больным.

Важно также ношение масок, мытье поверхностей в окружении больного, соблюдение режима проветривания. Ежегодная вакцинация против гриппа с возраста 6 месяцев снижает риск этой инфекции. Доказано также, что вакцинация детей от гриппа и пневмококковой инфекции уменьшает вероятность развития острого среднего отита у детей и осложненного течения ОРВИ. Надежных свидетельств о снижении респираторной заболеваемости под влиянием различных иммуномодуляторов — нет. Не доказана также профилактическая эффективность растительных препаратов и витамина С, гомеопатических препаратов.

 

Обратитесь к специалисту если:

 

— ребенок длительное время отказывается от питья — вы видите изменения в поведении: раздражительность, необычная сонливость со снижением реакции на попытки контакта с ребенком

— у ребенка имеется затруднение дыхания, шумное дыхание, учащение дыхания, втяжение межреберных промежутков, яремной ямки (места, расположенного спереди между шеей и грудью)

— у ребенка судороги на фоне повышенной температуры — у ребенка бред на фоне повышенной температуры

— повышенная температура тела (более 38,4-38,5ºC) сохраняется более 3 дней

— заложенность носа сохраняется без улучшения более 10-14 дней, особенно если при этом вы видите «вторую волну» повышения температуры тела и/или ухудшение состояния ребенка

— у ребенка есть боль в ухе и/или выделения из уха — у ребенка кашель, длящийся более 10-14 дней без улучшения

«Нужно ли пить антибиотики и делать прививки?»: томские врачи о гриппе и ОРВИ

Дмитрий Кандинский / vtomske. ru

Специалисты СибГМУ, врачи проекта «Томская область — лаборатория здоровья» рассказали о том, помогут ли при ОРВИ и гриппе БАДы, нужно ли сбивать температуру, пить антибиотики и делать прививки от гриппа.

Ранее сообщалось, что в Томской области в 2018 году планируется привить 436 231 человека, из них 117 194 ребенка, что составляет 45 % от населения всего региона. Прививочная кампания против гриппа началась 3 сентября. Первая партия вакцины поступила в количестве 141 820 доз для взрослых (45 % от потребности) и 52 986 — для детей (42,6 % от потребности). По данным на 3 октября, жители сделали более 125 тысяч прививок от гриппа.

Осень — период повышенного риска заболевания острой респираторной вирусной инфекцией (ОРВИ) и гриппом. Помогут ли иммунитету употребление БАДов, гомеопатических препаратов и апельсинов? Можно ли сбивать высокую температуру? Эти и другие мифы об ОРВИ, гриппе, их лечении и профилактике развеяла врач проекта «Томская область — лаборатория здоровья», кандидат медицинских наук, доцент кафедры инфекционных болезней и эпидемиологии СибГМУ Юлия Ковширина.

Первым устойчивым мифом, по словам Юлии Ковшириной, является убеждение в том, что применение витамина С позволит снизить риск заболевания ОРВИ.

«При достаточном употреблении витамина С человек более устойчив к инфекциям, однако убедительных данных, позволяющих назвать это вещество эффективным средством профилактики гриппа и ОРВИ, в настоящее время нет. Регулярное употребление витамина С и других витаминов не может считаться абсолютной защитой против гриппа и ОРВИ», — рассказала Юлия Ковширина.

Вторым мифом является убеждение многих людей в том, что температуру при ОРВИ и гриппе лучше не сбивать.

«Повышение температуры при инфекционном заболевании считается защитной реакцией, при которой вырабатываются интерфероны, позволяющие справиться с вирусами. Если кроме температуры в пределах 39 градусов нет других жалоб, ее можно не сбивать лекарствами, а использовать физические методы охлаждения — сделать обтирание, положить лед на голову и обеспечить обильное питье. При гриппе температура обычно бывает невысокой (около 37,5), но при этом человека могут беспокоить головная боль, боль в суставах, мышечная боль. В таких случаях можно назначать жаропонижающие препараты, обладающие еще и обезболивающим действием», — отметила специалист СибГМУ.

Согласно третьему распространенному мнению людей, при ОРВИ лучше использовать биологически активные добавки к пище, чем противовирусные препараты.

«Они не являются лекарственными средствами и не проходят такой уровень контроля эффективности, как лекарства. Поэтому не стоит ожидать терапевтического эффекта при использовании БАДов. При гриппе назначение противовирусных препаратов обязательно, иначе повышается вероятность развития тяжелых осложнений, которые могут привести даже к летальному исходу», — рассказала Юлия Ковширина.

По словам врача, также бытует мнение, что при ОРВИ ни в коем случае нельзя пить антибиотики.

«Действительно, при вирусных инфекциях назначение антибактериальных препаратов не обосновано, так как на вирусы они не действуют. Антибиотики назначают при наслоении бактериальных инфекций, например, если на фоне риновирусной инфекции развился отит. Иногда врач назначает антибиотик пациенту с ОРВИ, когда есть высокий риск возникновения бактериальных осложнений, например, пневмонии», — отметила специалист.

Еще один миф — если у болеющего гриппом нет температуры, он не заразен. Однако, по словам врача, если пациент болеет гриппом, он заразен первые три-семь дней, независимо от тяжести заболевания. Легкая форма гриппа может протекать без температурной реакции, но больной является источником инфекции, выделяя вирус в окружающую среду при кашле, чихании.

Распространено среди людей и мнение, что прививка от гриппа вызывает заболевание гриппом. Юлия Ковширина отмечает, что вакцина от гриппа не может вызвать заболевание гриппом, так как в ее состав входят частицы вирусов, которые не способны вызвать заболевание.

«Вакцинация проводится обычно в сентябре-октябре, когда регистрируется повышенная заболеваемость. Если после прививки появляются симптомы ОРЗ, более вероятно, что болезнь вызвана другими вирусами или бактериями, которыми можно заразиться в поликлинике, общественных местах, на работе», — рассказала Ковширина.

Среди мифов специалист выделила еще один о том, что грипп и ОРВИ — простые и неопасные заболевания, а значит необязательно посещать врача, чтобы выздороветь.

«Грипп является достаточно опасным заболеванием, что доказывают ежегодные случаи смерти заболевших. При подозрении на грипп (температура, выраженная интоксикация, минимальные катаральные явления) необходимо обратиться к врачу и как можно раньше начать прием противовирусного препарата. ОРВИ у некоторых могут осложниться пневмонией, отитом, менингитом, что требует более серьезного и длительного лечения. Именно поэтому, если возникшие симптомы ОРВИ беспокоят пациента, лучше обратиться к врачу и начать прописанное лечение», — отметила врач.

Грипп и простуда лечение эффективными препаратами в Ташкенте

Сбросить

Фильтр

  Таблетки Лоранекс (Loranex) 5 мг – антигистаминное, неседативное лекарственное средство для лечения аллергии.

Лекарство от аллергического ринита (жжения, зуда, насморка, слезоточения глаз), крапивницы (сыпи, кожного зуда, покраснения кожи) и прочих проявлений аллергии.

Применяется при аллергических реакциях на шерсть, пыльцу, бытовую пыль, морепродукты, фрукты и др.

Показать параметры

Грипп — острое инфекционное заболевание дыхательных путей, вызываемое вирусом гриппа. Входит в группу острых респираторных вирусных инфекций (ОРВИ). Периодически распространяется в виде эпидемий и пандемий.

У большинства людей симптомы гриппа проходят в течение недели без медицинской помощи. Но грипп может приводить к тяжелой болезни и смерти, особенно у людей из групп риска. По оценкам ВОЗ, ежегодные эпидемии гриппа приводят к 3−5 миллионам случаев тяжелой болезни и к 390−650 тысячам смертей. Реконвалесцентный период составляет 7−15 дней.

 

Просту́да или простудное заболевание — применяемое в простонародье понятие, обобщающее симптомы расстройств верхних дыхательных путей вследствие инфекции вирусной или смешанной этиологии. Раньше считалось, что простуда вызывается охлаждением организма, однако современной науке известно, что она вызывается более чем 200-ми различными вирусами, при этом в большей части случаев заболеваемости причиной являются риновирусы, а бактериальная инфекция обнаруживается лишь в 5 % случаев.

 

На нашем сайте вы найдете все что доктор прописал! 

 

КАТАЛОГ

Наверх

Профилактика гриппа и ОРВИ, Covid-2019 | ДСП 47


Памятка: Профилактика гриппа, ОРВИ и коронавирусной инфекции

Грипп, коронавирусная инфекция и другие острые респираторные вирусные инфекции (ОРВИ) находятся на первом месте по числу ежегодно заболевающих людей.

Несмотря на постоянные усилия, направленные на борьбу с возбудителями гриппа, коронавирусной инфекции и других ОРВИ победить их до сих пор не удается.

Ежегодно от осложнений гриппа погибают тысячи человек.

Это связано с тем, что вирусы, прежде всего вирусы гриппа и коронавирусы обладают способностью менять свою структуру и мутировавший вирус, способен поражать человека вновь. Так, переболевший гриппом человек имеет хороший иммунный барьер, но тем не менее новый измененный вирус, способен легко проникать через него, так как иммунитета против этого вида вируса организм пока не выработал.

Вирусы гриппа, ОРВИ и коронавирусной инфекции вызывают у человека респираторные заболевания разной тяжести. Симптомы заболевания аналогичны симптомам обычного (сезонного) гриппа. Тяжесть заболевания зависит от целого ряда факторов, в том числе от общего состояния организма и возраста.

Предрасположены к заболеванию: пожилые люди, маленькие дети, беременные женщины и люди, страдающие хроническими заболеваниями (астмой, диабетом, сердечно-сосудистыми заболеваниями), и с ослабленным иммунитетом.

 



ПРАВИЛО 1. ЧАСТО МОЙТЕ РУКИ С МЫЛОМ

  • Чистите и дезинфицируйте поверхности, используя бытовые моющие средства.
  • Гигиена рук — это важная мера профилактики распространения гриппа и коронавирусной инфекции. Мытье с мылом удаляет вирусы. Если нет возможности помыть руки с мылом, пользуйтесь спиртсодержащими или дезинфицирующими салфетками.
  • Чистка и регулярная дезинфекция поверхностей (столов, дверных ручек, стульев, гаджетов и др.) удаляет вирусы. 

ПРАВИЛО 2. СОБЛЮДАЙТЕ РАССТОЯНИЕ И ЭТИКЕТ

Вирусы передаются от больного человека к здоровому воздушно -капельным путем (при чихании, кашле), поэтому необходимо соблюдать расстояние не менее 1 метра от больных.

  • Избегайте трогать руками глаза, нос или рот. Вирус гриппа и коронавирус распространяются этими путями.
  • Надевайте маску или используйте другие подручные средства защиты, чтобы уменьшить риск заболевания.
  • При кашле, чихании следует прикрывать рот и нос одноразовыми салфетками, которые после использования нужно выбрасывать.
  • Избегая излишние поездки и посещения многолюдных мест, можно уменьшить риск заболевания.

ПРАВИЛО 3. ВЕДИТЕ ЗДОРОВЫЙ ОБРАЗ ЖИЗНИ

Здоровый образ жизни повышает сопротивляемость организма к инфекции. Соблюдайте здоровый режим, включая полноценный сон, потребление пищевых продуктов богатых белками, витаминами и минеральными веществами, физическую активность.

ПРАВИЛО 4.  ЗАЩИЩАЙТЕ ОРГАНЫ ДЫХАНИЯ С ПОМОЩЬЮ МЕДИЦИНСКОЙ МАСКИ

Среди прочих средств профилактики особое место занимает ношение масок, благодаря которым ограничивается распространение вируса.

Медицинские маски для защиты органов дыхания используют:

  • при посещении мест массового скопления людей, поездках в общественном транспорте в период роста заболеваемости острыми респираторными вирусными инфекциями;
  • при уходе за больными острыми респираторными вирусными инфекциями;
  • при общении с лицами с признаками острой респираторной вирусной инфекции;
  • при рисках инфицирования другими инфекциями, передающимися воздушно-капельным путем.

 ПРАВИЛО 5.  ЧТО ДЕЛАТЬ В СЛУЧАЕ ЗАБОЛЕВАНИЯ ГРИППОМ, КОРОНАВИРУСНОЙ ИНФЕКЦИЕЙ?

Оставайтесь дома и срочно обращайтесь к врачу.
Следуйте предписаниям врача, соблюдайте постельный режим и пейте как можно больше жидкости.

Для кого наиболее опасна встреча с вирусом?

Особо тяжело переносят инфекцию дети и пожилые люди, для этих возрастных групп очень опасны осложнения, которые могут развиться во время заболевания. Дети болеют более тяжело в связи с тем, что их иммунная система еще не встречалась с данным вирусом, а для пожилых людей, также, как и для людей с хроническими заболеваниями, вирус опасен по причине ослабленной иммунной системы.

Группы риска:

  • Дети
  • Люди старше 60 лет
  • Люди с хроническими заболеваниями легких (бронхиальная астма, хроническая обструктивная болезнь легких)
  • Люди с хроническими заболеваниями сердечно-сосудистой системы (врожденные пороки сердца, ишемическая болезнь сердца, сердечная недостаточность)
  • Беременные женщины
  • Медицинские работники
  • Работники общественного транспорта, предприятий общественного питания

Каковы симптомы гриппа/коронавирусной инфекции:

  • высокая температура тела,
  • озноб,
  • головная боль,
  • слабость,
  • заложенность носа,
  • кашель,
  • затрудненное дыхание,
  • боли в мышцах,
  • конъюнктивит (возможно).
  • в некоторых случаях могут быть симптомы желудочно-кишечных расстройств: тошнота, рвота, диарея.

Каковы осложнения:

  • Среди осложнений лидирует вирусная пневмония. Ухудшение состояния при вирусной пневмонии идёт быстрыми темпами, и у многих пациентов уже в течение 24 часов развивается дыхательная недостаточность, требующая немедленной респираторной поддержки с механической вентиляцией лёгких.
  • Энцефалит, менингит
  • Осложнения беременности, развитие патологии плода
  • Обострение хронических заболеваний

Быстро начатое лечение способствует облегчению степени тяжести болезни.

Что делать если в семье кто-то заболел гриппом/ коронавирусной инфекцией?

  • Вызовите врача.
  • Выделите больному отдельную комнату в доме. Если это невозможно, соблюдайте расстояние не менее 1 метра от больного.
  • Ограничьте до минимума контакт между больным и близкими, особенно детьми, пожилыми людьми и лицами, страдающими хроническими заболеваниями.
  • Часто проветривайте помещение.
  • Сохраняйте чистоту, как можно чаще мойте и дезинфицируйте поверхности бытовыми моющими средствами.
  • Часто мойте руки с мылом.

                Ухаживая за больным, прикрывайте рот и нос маской или другими защитными средствами (платком, шарфом и др.).
                Ухаживать за больным должен только один член семьи.

 

Антибиотики

Принимать антибиотики в первые дни заболевания — большая ошибка. Антибиотики не способны справиться с вирусом, кроме того, они неблагоприятно влияют на нормальную микрофлору. Антибиотики назначает только врач, только в случае развития осложнений, вызванных присоединением бактериальной инфекции. Принимать антибактериальные препараты в качестве профилактики развития осложнений- опасно и бесполезно.

Заболевший человек должен оставаться дома и не создавать угрозу заражения окружающих.

Профилактика

Самым эффективным способом профилактики гриппа является ежегодная вакцинация. Состав вакцины против гриппа меняется ежегодно. Прежде всего, вакцинироваться рекомендуется тем, кто входит в группу риска. Оптимальное время для вакцинации октябрь-ноябрь. Вакцинация детей против гриппа возможна, начиная с 6-месячного возраста.

Вакцины против большинства возбудителей острых респираторных вирусных инфекций не разработаны.


Грипп, коронавирус, другие ОРВИ — поможет маска!

В период активной циркуляции возбудителей гриппа, коронавирусной инфекции, и других возбудителей острых респираторных вирусных инфекций напоминаем о целесообразности использования одноразовой медицинской маски в качестве эффективной меры профилактики заражения и ограничения распространения инфекции.

Эти вирусы передаются от человека к человеку преимущественно воздушно-капельным путём, через микрокапли респираторных выделений, которые образуются, когда инфицированные люди говорят, чихают или кашляют.

С воздухом эти капли могут попасть на поверхность слизистой оболочки верхних дыхательных путей здоровых людей, которые находятся рядом с заражённым человеком.

Заражение может происходить и в результате непосредственного или косвенного контакта здорового человека с респираторными выделениями инфицированного.

Использование одноразовой маски снижает вероятность заражения гриппом, коронавирусом и другими орви

  • Надевайте маску в закрытых помещениях, в местах большого скопления людей, при контактах с людьми с симптомами вирусного респираторного заболевания
  • Если у вас симптомы вирусного респираторного заболевания и вам необходимо обратиться к врачу, заблаговременно наденьте маску, чтобы защитить окружающих в зоне ожидания
  • Маска должна плотно прилегать к лицу и закрывать рот, нос и подбородок
  • При наличии вшитого крепления в области носа, его надо плотно прижать к спинке носа
  • Если на маске есть специальные складки, – расправьте их
  • Меняйте маску на новую каждые 2-3 часа или чаще 
  • Выбрасывайте маску в урну сразу после использования
  • После прикосновения к использованной маске, – тщательно вымойте руки с мылом
  • Носить маску на безлюдных открытых пространствах – нецелесообразно 
  • Используйте маску однократно, повторно использовать маску нельзя
  • Только в сочетании с тщательной гигиеной рук и карантинными мерами использование маски будет максимально эффективно для предотвращения заражения и распространения инфекции

 


Информационные материалы, посвященные профилактике гриппа и ОРВИ

 

 

Чувствительность к вирусу и клиническая эффективность противогриппозных препаратов во время сезона гриппа 2010–2011 гг. В России

Основные моменты

Было обнаружено, что вирусы гриппа из сезона эпидемии 2010–2011 гг. Чувствительны к осельтамивиру и умифеновиру.

Умифеновир оказался эффективным против устойчивых к осельтамивиру вирусов гриппа в анализах на основе клеточных культур.

Осельтамивир и умифеновир оказались эффективными против инфекции, вызванной пандемическим вирусом A (h2N1) pdm09 у мышей.

Лечение осельтамивиром и умифеновиром уменьшило продолжительность симптомов у госпитализированных больных гриппом.

Резюме

История вопроса

Противовирусные препараты являются важным дополнением к вакцинации против гриппа. В этом исследовании определялась чувствительность in vitro вирусов гриппа A и B, выделенных в сезоне 2010–2011 гг. В России, к ингибитору нейраминидазы осельтамивиру и ингибитору слияния гемагглютинина умифеновиру и клиническая эффективность этого противовирусного препарата в этом сезоне.

Методы

Оценивали противовирусную активность этих препаратов против вируса A (h2N1) pdm09 у мышей. Важно отметить, что клиническая эффективность осельтамивира и умифеновира оценивалась в ретроспективном исследовании, проведенном в 26 регионах России.

Результаты

Все протестированные вирусы ( n = 36) были чувствительны к осельтамивиру и умифеновиру in vitro. Осельтамивир (10 мг / кг / день) и умифеновир (60 мг / кг / день) значительно увеличили выживаемость мышей, зараженных вирусом A / California / 04/2009 (h2N1) pdm09 ( p <0.05). Инфекция гриппа была лабораторно подтверждена у 442 больных из 1462 госпитализированных с острыми респираторными инфекциями. Лечение инфицированных гриппом пациентов в течение 48 часов с момента появления симптомов осельтамивиром и умифеновиром было связано со значительным сокращением продолжительности заболевания (2–3 дня) и симптомов ( p <0,001). Пневмония не наблюдалась ни у одного из пациентов, получавших осельтамивир, и у 0,3% пациентов, получавших умифеновир, по сравнению с 23.7% пациентов, не получавших противовирусную терапию ( p <0,001).

Выводы

Это исследование предоставило экспериментальные и клинические доказательства эффективности осельтамивира и умифеновира против вирусов гриппа, представители которых продолжали циркулировать в постпандемические сезоны.

Ключевые слова

Умифеновир

Осельтамивир

Чувствительность к противовирусным препаратам

Наблюдательное исследование

Грипп

Рекомендуемые статьиЦитирующие статьи (0)

Просмотреть аннотацию

Copyright © 2016 Авторы.Опубликовано Elsevier Ltd.

Рекомендуемые статьи

Цитирующие статьи

(PDF) Комбинированная терапия гриппа противовирусными препаратами с другим механизмом действия по сравнению с монотерапией

ССЫЛКИ

[1] Dawood, FS, Iuliano, AD , Рид, К., Мельцер, М.И., Шей, Д.К.,

Ченг, П.-Й.,… Виддоусон, М.-А. (2012). Расчетная глобальная смертность

, связанная с первыми 12 месяцами пандемии 2009 г.

Циркуляция вируса гриппа A h2N1: модельное исследование.Ланцет

Инфекционные болезни, 12 (9), 687–695.

[2] Ленева И.А., Бурцева Е.И., Яцышина С.Б., Федякина И.Т.,

Кириллова Е.С., Селькова Е.П.,… Малеев В.В. (2016). Вирус

Чувствительность и клиническая эффективность противогриппозных препаратов

во время сезона гриппа 2010–2011 гг. В России. Международный

Журнал инфекционных болезней, 43, 77–84.

[3] Гроскопф, Л. А., Соколов, Л. З., Бродер, К. Р., Олсен, С. Дж.,

Каррон, Р. А., Джерниган, Д. Б., и Брези, Дж. С. (2016). Профилактика

и борьба с сезонным гриппом с помощью вакцин. MMWR.

Рекомендации и отчеты, 65 (5), 1–54.

[4] Сологуб Т.В., Токин И.И., Цветков В.В. и Цыбалова Л.М. (2017).

Грипп в практике клиники, эпидемиолога и вирусолога. Москва,

с. 272 ​​

[5] Добровольный, Г.М., Бошемин, К. А. А. (2017). Моделирование

возникновения лекарственной устойчивости гриппа: роль поверхностных белков

, иммунный ответ и противовирусные механизмы. PLOS

ONE, 12 (7), e0180582.

[6] Пирес де Мелло, К. П., Друсано, Г. Л., Адамс, Дж. Р., Шадт, М.,

Кулави, Р., и Браун, А. Н. (2018). Комбинированная терапия осельтамивир-занамивир

подавляет лекарственно-устойчивые вирусы гриппа A

h2N1 в системе модели инфекции полых волокон (HFIM).

Европейский журнал фармацевтических наук, 111, 443–449.

[7] Тильманис, Д., Ван Баален, К., О, Д. Ю., Россиньол, Дж. Ф., и Херт, А.

С. (2017). Чувствительность циркулирующих вирусов гриппа человека

к тизоксаниду, активному метаболиту нитазоксанида. Противовирусные

Исследования, 147, 142–148.

[8] Шибнев В. А., Гараев Т. М., Финогенова М. П., Шевченко Е.

С., Бурцева Е. И. (2012). Новые производные адамантана

могут преодолеть устойчивость вирусов гриппа A (h2N1) pdm2009 и A (h4N2)

к ремантадину.Бюллетень экспериментальной биологии и медицины

, 153 (2), 233–235.

[9] Ли, Т., Чан, М., и Ли, Н. (2015). Клинические последствия

устойчивости к противовирусным препаратам при гриппе. Вирусы, 7 (9), 4929–4944.

[10] Naesens, L., Stevaert, A., & Vanderlinden, E. (2016). Противовирусные

методов лечения гриппа на горизонте. Current Opinion in

Pharmacology, 30, 106–115.

[11] Фазылов В.К., Ситников И.Г., Силина Е.В., Шевченко С.Б.,

Можина Л. Н., Замятина Л. Л.,… Корсантия Б. М. (2016).

Ежедневное лечение ОРВИ и гриппа

Клиническая практика: результаты многоцентрового международного наблюдательного исследования

FLU-EE. Терапевтический Архив, 88 (11), 68. d

[12] Щелканов М.Ю., Попов А.Ф., Симакова А.И., Зенин И.В., Прошина

Е.С., Кириллов И.М., Дмитренко К.А. и Шевчук Д.В. (2015).

Патогенез гриппа: механизмы модуляции белками агента

.Журнал инфектологии, 7 (2), 31-46.

[13] Таннер, Э. Дж., Киркегаард, К. А., и Вайнбергер, Л. С. (2016).

Использование генетических помех для противовирусной терапии. PLOS

Genetics, 12 (5), e1005986.

[14] Arias, CF, Escalera-Zamudio, M., de los Dolores Soto-Del Río,

M., Georgina Cobián-Güemes, A., Isa, P., & López, S. (2009) .

Молекулярная анатомия вируса гриппа А 2009 г. (h2N1). Архив

медицинских исследований, 40 (8), 643–654.

[15] Вебстер Р. Г., Говоркова Е. А. (2014). Постоянные вызовы

по гриппу. Анналы Нью-Йоркской академии наук,

1323 (1), 115–139.

[16] Борискин Ю., Ленева И., Печер Э.-И., Поляк С. (2008).

Арбидол: противовирусное соединение широкого спектра действия, блокирующее вирус

Fusion. Текущая лекарственная химия, 15 (10), 997–1005.

[17] Ленева, И. А., Рассел, Р. Дж., Борискин, Ю. С., и Хэй, А. Дж.(2009).

Характеристики устойчивых к арбидолу мутантов вируса гриппа:

Влияние на механизм противогриппозного действия арбидола.

Антивирусные исследования, 81 (2), 132–140.

[18] Teissier, E., Zandomeneghi, G., Loquet, A., Lavillette, D., Lavergne,

,

GP., Montserret, R., Cosset, FL., Böckmann, A., Meier, B ., Penin,

F., & Pécheur, EI. (2011). Механизм ингибирования слияния оболочечных мембран вируса

противовирусным препаратом арбидол А.Пасторе,

изд. PLoS ONE, 6 (1), p.e15874.

[19] Блезинг, Дж. Леви, П.Л., Поляк, С.Дж., Станифер, М., Булан, С. и С.

Пешер, E-I. (2013). Арбидол подавляет проникновение вируса, препятствуя

клатрин-зависимому трафику. Антивирусные исследования, 100 (1), 215–219.

[20] Джефферсон, Т., Джонс, М.А., Доши, П., Дель Мар, К.Б., Хенеган, С.Дж.,

Хама Р. и Томпсон, М., Дж. (2012). Ингибиторы нейраминидазы

для профилактики и лечения гриппа у здоровых взрослых и детей T.

Джефферсон, изд. Кокрановская база данных систематических обзоров, 18 (1),

CD008965

[21] Джефферсон, Т., Джонс, М., Доши, П., Спенсер, Э.А., Онакпоя, И. и

Хенеган С.Дж., (2014 г.) ). Осельтамивир для лечения гриппа у взрослых и

детей: систематический обзор отчетов о клинических исследованиях и резюме

нормативных комментариев. BMJ, 348, 2545 – g2545

[22] Сологуб Т.В., Цветков В.В. (2017). Кагоцел в терапии

гриппа и ОРВИ: анализ данных и систематизация

по результатам доклинических и клинических исследований.

Терапевтический архив, 89 (8), 113

[23] Berry, C.M. (2016). Понимание терапии подтипа интерферона для

вирусных инфекций: использование силы врожденной иммунной системы

. Обзоры цитокинов и факторов роста, 31, 83–90.

[24] Хайден Ф. (2002). Руководство ВОЗ по использованию вакцин и противовирусных препаратов

во время гриппа. Приложение 5 — Рекомендации по использованию противовирусных препаратов

во время пандемии гриппа. Женева,

WHO / CDS / CSR / RMD / 2004.8

[25] Монто А. (2008). Чувствительность к вирусам и выбор противовирусных препаратов от гриппа

. Клинические инфекционные болезни, 47, 346–348.

Александр Федорович Попов и др. / Ж. Pharm. Sci. & Res. Vol. 10 (2), 2018, 357-360

Тамифлю и Реленза проверяют эффективность против гриппа

Тамифлю и Реленза — препараты, обычно используемые для профилактики и лечения гриппа у взрослых и детей. Прошлые исследования приветствовали препараты для снижения количества госпитализаций и осложнений в результате вируса.Но в последнем Кокрановском обзоре, недавно опубликованном в BMJ , исследователи говорят, что нет веских доказательств в поддержку таких утверждений.

Тамифлю (осельтамивир) и Реленза (занамивир) — это классы препаратов, известных как ингибиторы нейраминидазы. Считается, что оба препарата предотвращают и уменьшают симптомы гриппа, останавливая распространение вируса гриппа внутри организма.

В настоящее время Тамифлю используется для борьбы с гриппом у пациентов в возрасте 2 недель и старше, симптомы которых не длились более 2 дней.Его можно использовать для профилактики гриппа у пациентов в возрасте от 1 года и старше. Relenza используется для лечения гриппа у пациентов в возрасте 7 лет и старше и может использоваться для профилактики гриппа у пациентов в возрасте 5 лет и старше.

По словам исследователей, участвовавших в этом последнем обзоре, включая доктора Карла Хенегана из Оксфордского университета в Великобритании и доктора Питера Доши из фармацевтической школы Университета Мэриленда в США, оба препарата хранятся в запасах для использования против сезонных заболеваний. и пандемический грипп. Например, США потратили более 1 доллара.3 миллиарда на резервы противовирусных препаратов.

Это накопление основано на международных и национальных рекомендациях таких организаций, как Всемирная организация здравоохранения (ВОЗ) и Центры по контролю и профилактике заболеваний (CDC). Но на чем основаны их рекомендации? В последнем Кокрановском обзоре поставлены под сомнение преимущества противовирусных препаратов от гриппа Тамифлю и Раленза.

Команда говорит, что для Европейского CDC рекомендации по ингибиторам нейраминидазы были основаны на сводке преимуществ и вреда, проведенных Европейским агентством по лекарственным средствам (EMA), в то время как другие рекомендации были основаны на результатах испытаний, проведенных производителями лекарств, такими как GlaxoSmithKline. (ГСК).

В 2009 году исследователи Кокрейн попытались проверить безопасность и эффективность ингибиторов нейраминидазы. Однако производители лекарств отказались предоставить полный доступ к данным клинических испытаний лекарств, что помешало их усилиям.

Это вызвало вопросы о том, точно ли сообщалось о рисках и преимуществах противовирусных препаратов от гриппа и следует ли их накапливать для лечения сезонного и пандемического гриппа у детей и взрослых.

В 2012 году, Medical News Today сообщил о том, как BMJ оказывали давление на Roche — производителей Тамифлю — с целью обнародования данных испытаний этого препарата.

Теперь, получив доступ к исходным данным клинических испытаний, исследователи смогли проанализировать 20 полных внутренних отчетов о влиянии Тамифлю и 26 отчетов об эффектах Релензы. Всего в отчетах приняли участие более 24000 человек.

Рассматривая преимущества Тамифлю, исследователи обнаружили, что это лекарство привело к более быстрому облегчению симптомов гриппа всего на полдня (с 7 дней до 6,3 дня) по сравнению с препаратом плацебо.

Тамифлю не уменьшил количество госпитализаций или осложнений от серьезного гриппа, такого как пневмония, бронхит, синусит или ушная инфекция, у взрослых и детей.

Исследователи обнаружили, что препарат усиливает тошноту и рвоту у взрослых и детей на 4% и 5% соответственно. Когда Тамифлю использовался для профилактики гриппа, риск психических расстройств увеличивался на 1%. Об этих эффектах не сообщалось в первоначальных публикациях клинических испытаний.

Кроме того, команда обнаружила, что Тамифлю не дает некоторым людям вырабатывать достаточно собственных антител для борьбы с инфекцией гриппа.

Комментируя эти выводы, д-р.Дэвид Тови, главный редактор Cochrane, говорит:

«Изначально предполагалось, что он поможет снизить количество госпитализаций и серьезных осложнений от гриппа, в обзоре подчеркивается, что Тамифлю не доказал свою эффективность, и, похоже, он приводит к вредным эффектам, которых не было. полностью сообщается в оригинальных публикациях. Это показывает важность обеспечения прозрачности и доступности данных испытаний ».

Результаты были аналогичными для Relenza. Было обнаружено, что препарат сокращает продолжительность симптомов гриппа с 6.От 6 до 6 дней у взрослых — что эквивалентно 14,4 часа — по сравнению с препаратом плацебо. У детей значительного эффекта не обнаружено.

Команда не нашла доказательств того, что Relenza снижает риск осложнений гриппа или риск госпитализации.

Основываясь на своих выводах, исследователи говорят, что рекомендации по использованию Тамифлю и Релензы для профилактики или лечения гриппа должны быть пересмотрены.

«Утверждение и использование лекарств больше не может основываться на предвзятой или отсутствующей информации.Мы слишком много рискуем для здоровья и экономики нашего населения », — говорят авторы.

Они отмечают, что этот обновленный Кокрановский обзор является первым, основанным только на клинических исследованиях и комментариях регулирующих органов, что означает, что результаты «намного богаче».

«Мы призываем людей не доверять только опубликованным испытаниям или комментариям противоречивых лиц, принимающих решения в области здравоохранения, а просматривать информацию самостоятельно», — добавляют они.

В редакционной статье, связанной с обзорами, доктор Тови вместе с главным редактором BMJ Фионой Годли и клиническим редактором Элизабет Лодер отмечают, что результаты этого обзора подчеркивают необходимость предоставления всех данных из клинических лабораторий. испытания лекарств, используемых в настоящее время, чтобы можно было тщательно проанализировать всю информацию.

«Исключительные усилия Кокрановских обозревателей привели к тому, что должно было быть рутинным делом — независимой проверке данных клинических испытаний», — добавляют они.

«Они показали с большей ясностью, чем когда-либо, что нынешняя система сломана. Нам предстоит еще немало сражений, прежде чем у нас будет система оценки и эмуляции лекарств, которая действительно будет служить пациентам и общественным интересам ».

Новый ингибитор малых молекул вирусов гриппа А, который нацелен на функцию полимеразы и косвенно индуцирует интерферон

Abstract

Вирусы гриппа продолжают представлять серьезную угрозу общественному здоровью во всем мире, и возможности противовирусной терапии ограничиваются появлением штаммов вирусов, устойчивых к лекарствам.Противовирусный цитокин интерферон (IFN) является важным медиатором врожденного иммунного ответа, и вирусы гриппа, как и многие вирусы, разработали стратегии, позволяющие избежать этого ответа, что привело к усилению репликации и повышенной патогенности. Клеточный анализ, который отслеживает продукцию IFN, был разработан и применен в высокопроизводительном скрининге соединений для идентификации молекул, которые восстанавливают ответ IFN на клетки, инфицированные вирусом гриппа. Мы сообщаем об идентификации соединения ASN2, которое индуцирует IFN только при наличии инфекции вируса гриппа.ASN2 преимущественно подавляет рост вирусов гриппа A, включая пандемические штаммы h2N1 1918, h4N2 1968 и h2N1 2009, а также вирус птичьего H5N1. In vivo , ASN2 частично защищает мышей, зараженных летальной дозой вируса гриппа А. Неожиданно мы обнаружили, что противовирусная активность ASN2 не зависит от продукции IFN и передачи сигналов. Скорее, его свойство индуцировать IFN, по-видимому, является косвенным эффектом, возникающим в результате опосредованного ASN2 ингибирования функции вирусной полимеразы и последующей потери экспрессии вирусного антагониста IFN, NS1.Более того, мы идентифицировали единственную аминокислотную мутацию в положении 499 белка PB1 вируса гриппа, которая придает устойчивость к ASN2, предполагая, что PB1 является прямой мишенью. Этот двусторонний противовирусный механизм, состоящий из прямого ингибирования репликации вируса и одновременной активации врожденного иммунного ответа хозяина, является уникальным свойством, ранее не описанным ни для одной противовирусной молекулы.

Сведения об авторе

У вирусов гриппа быстро развивается устойчивость к доступным противогриппозным препаратам, и, следовательно, существует острая потребность в новых подходах к лечению.Мы идентифицировали соединение ASN2 с помощью высокопроизводительного скрининга молекул, которые способны индуцировать противовирусный цитокиновый интерферон (IFN) в присутствии инфекции вируса гриппа. Обычно вирус гриппа блокирует продукцию IFN, активность, которая зависит от вирусного белка NS1 и способствует способности вируса вызывать заболевание у инфицированного хозяина. Мы показываем, что ASN2 является мощным ингибитором вируса гриппа A и может частично защищать инфицированных животных от болезней и смерти. ASN2 действует путем нацеливания на функцию полимеразы вируса гриппа, что приводит к ингибированию репликации вируса и, как следствие, экспрессии NS1.Таким образом, способность ASN2 индуцировать IFN является «побочным эффектом», хотя и желательным, ингибирования полимеразы. Эта комбинация прямого ингибирования вируса при одновременном стимулировании иммунного ответа хозяина является новым свойством противовирусного соединения.

Образец цитирования: Ortigoza MB, Dibben O, Maamary J, Martinez-Gil L, Leyva-Grado VH, Abreu P Jr, et al. (2012) Новый ингибитор малых молекул вирусов гриппа A, который нацелен на функцию полимеразы и косвенно индуцирует интерферон.PLoS Pathog 8 (4): e1002668. doi: 10.1371 / journal.ppat.1002668

Редактор: Канта Суббарао, Национальные институты здравоохранения, Соединенные Штаты Америки

Поступила: 8 декабря 2011 г .; Одобрена: 8 марта 2012 г .; Опубликован: 26 апреля 2012 г.

Авторские права: © 2012 Ortigoza et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Финансирование: Эта работа была частично поддержана грантами Национальных институтов здравоохранения (NIH): U54 AI057159, U01 AI1074539, HHSN2722002C, R21AI083673. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Введение

Вирусы гриппа являются членами семейства Orthomyxoviridae [1] и являются этиологическими агентами гриппа, инфекционного, острого и респираторного заболевания с лихорадкой.В Соединенных Штатах сезонный грипп поражает примерно 5–20 процентов населения, а смертность от гриппа колеблется от 3 300 до 48 600 (в среднем 23 600) ежегодно, несмотря на наличие вакцин и противовирусных препаратов [2]. Потребность в эффективных противовирусных препаратах стала особенно очевидной во время пандемии 2009 года, когда они использовались как терапевтически, так и профилактически в период до того, как вакцина стала доступной [3]. Это также побудило FDA предоставить временное экстренное разрешение на применение перамивира, ингибитора нейраминидазы, который вводится внутривенно и, следовательно, полезен для лечения пациентов с механической вентиляцией легких [4].Даже в обычные сезоны гриппа определенные группы населения (например, пожилые люди или люди с ослабленным иммунитетом), у которых слабый ответ на вакцинацию, зависят от наличия эффективных противовирусных препаратов для лечения инфекций и предотвращения передачи.

В настоящее время существует два класса одобренных FDA препаратов для лечения или химиопрофилактики гриппа [5]. Ингибиторы M2, амантадин и римантадин, блокируют активность ионного канала, образованного M2, и тем самым предотвращают высвобождение сегментов вирусного генома в цитоплазму [6].Скорость появления вирусов, устойчивых к этим препаратам, увеличивается во всем мире, что значительно снижает их эффективность. Фактически, все циркулирующие в настоящее время штаммы вируса гриппа A (пандемический A / h2N1 2009 г. и сезонный A / h4N2) устойчивы к ингибиторам M2 [7], [8], [9], и поэтому эти препараты больше не рекомендуются для лечения. лечение гриппа.

Другой класс противовирусных препаратов, одобренных для лечения инфекций гриппа A и B, — это ингибиторы нейраминидазы (NA), осельтамивир и занамивир.Ингибиторы NA связывают белок NA и блокируют его ферментативную активность, тем самым предотвращая эффективное высвобождение вновь синтезированных вирусов из инфицированных клеток [1]. Быстрый рост устойчивости к осельтамивиру наблюдался среди сезонных изолятов A / h2N1 до пандемии 2009 г. [10]. Однако новые пандемические вирусы A / h2N1, которые с тех пор заменили сезонные вирусы h2N1, сохраняют чувствительность к осельтамивиру. Таким образом, хотя все циркулирующие в настоящее время вирусы гриппа чувствительны к ингибированию ингибиторами нейраминидазы, они остаются единственным классом противовирусных препаратов, доступных для лечения инфекций гриппа.Поэтому крайне необходимы новые противовирусные стратегии, включая различные вирусные мишени, клеточные мишени или иммуномодулирующие препараты. Из разрабатываемых антивирусных препаратов, действующих по новому механизму, наиболее перспективным оказался Т-705 (фавипиравир) in vitro и in vivo , ингибируя вирус гриппа и другие РНК-вирусы [11], [12]. Т-705 метаболизируется внутриклеточно с образованием рибофуранозилтрифосфата Т-705, который действует как аналог пурина и ингибирует синтез вирусной РНК [13].

На клинический исход гриппа влияет взаимодействие между вирусом и хозяином, а интерфероны типа I (IFN-α / β) являются основными медиаторами врожденного иммунного ответа хозяина. Эти цитокины индуцируются после вирусной инфекции и создают антивирусное состояние как в инфицированных, так и в соседних клетках, стимулируя экспрессию антивирусных генов, известных как гены, стимулированные интерфероном (ISG). Благодаря мощным противовирусным свойствам IFN-α / β и ISG, многие вирусы разработали стратегии, позволяющие избежать этого ответа.В частности, вирусы часто кодируют белки, обычно называемые антагонистами IFN, которые нацелены на пути, участвующие в продукции и / или ответе на IFN-α / β [14]. Для вирусов гриппа A основным антагонистом IFN является белок NS1 [15], который представляет собой многофункциональный белок, присутствующий в высоких концентрациях в инфицированных клетках. Основная роль, приписываемая NS1, заключается в его способности ингибировать ответ IFN-α / β как на уровне продукции IFNβ, так и на уровне активности некоторых ISG [15], [16]. Доказательства того, что NS1 важен для патогенеза, получены из открытия, что вирусы, лишенные функционального белка NS1, ослаблены и не вызывают заболевания [15], [17], [18], [19], [20].Эти вирусы разрабатываются как кандидаты для живых аттенуированных вакцин против вируса гриппа [21], и по аналогичным соображениям NS1 представляет собой новую привлекательную мишень для противовирусных препаратов против гриппа [22].

Используя клеточный анализ, который отслеживает индукцию IFN-β, мы проверили библиотеки низкомолекулярных соединений на их способность восстанавливать продукцию IFN-β в клетках, инфицированных вирусом гриппа А. Наш высокопроизводительный скрининг выявил соединение ASN2, которое эффективно ингибирует вирус гриппа с помощью механизма, отличного от существующих противовирусных препаратов гриппа.Это первое сообщение о противовирусном соединении, способном ингибировать функцию полимеразы вируса гриппа, одновременно активируя врожденную иммунную систему.

Результаты

Обозначение ASN2

Для скрининга соединений с малой молекулярной массой в формате с высокой пропускной способностью было важно разработать первичный скрининговый анализ, который был бы простым, быстрым и надежным. Для этой цели мы использовали стабильную линию репортерных клеток MDCK (MDCK IFNβ-люцифераза) [23], которая обеспечивает простое измерение индукции IFN.Когда эти клетки инфицированы вирусом гриппа дикого типа, экспрессия репортерного гена не активируется из-за присутствия кодируемого вирусом белка NS1, который блокирует индуцированную вирусом активацию промотора IFNβ (рис. 1A). Однако инфицирование мутантным вирусом гриппа, содержащим нефункциональный белок NS1 (rPR8 NS1-113 [21]), приводит к устойчивой активации репортера. Скрининговый анализ включал инфицирование репортерных клеток MDCK IFNβ-люциферазы вирусом гриппа дикого типа A / PR / 8/34 в присутствии соединений библиотеки с целью идентификации тех, которые восстанавливают ответ IFNβ.

ExpandFigure 1. Концепция высокопроизводительного комплексного скрининга и идентификации ASN2.

(A) Клетки MDCK, стабильно экспрессирующие репортер IFNβ-люциферазы, не реагируют на инфекцию вирусом гриппа A дикого типа (wt) из-за присутствия полностью функционального белка NS1 (левая панель). Инфекция мутантным вирусом, экспрессирующим усеченный белок NS1 (rPR8 NS1-113), который не может противодействовать пути продукции IFNβ, может индуцировать репортер IFNβ-люциферазы (средняя панель). Тест HTS заключался в инфицировании репортерных клеток вирусом гриппа A дикого типа в присутствии соединений с малой молекулярной массой.Цель состояла в том, чтобы идентифицировать соединения, которые способны восстанавливать IFNβ в присутствии вируса гриппа A дикого типа (правая панель). (B) Химическая структура ASN2 с его молекулярной массой (MW) и химической формулой. (C) Репортерные анализы клеток MDCK IFNβ-люциферазы, обработанных увеличивающимися концентрациями ASN2 в течение 2 часов до имитации инфекции или инфицирования вирусом гриппа A / PR / 8/34 и VSV-GFP. Активность люциферазы определяли через 18 часов после заражения. Кривые представляют собой среднее трех значений ± стандартное отклонение.

doi: 10.1371 / journal.ppat.1002668.g001

Более »

Анализ первичного скрининга был первоначально оптимизирован для 96-луночного формата, а затем уменьшен до 384-луночного формата. Мы проверили его пригодность для использования на экране с высокой пропускной способностью по следующим параметрам: коэффициент Z ‘0,5 [24], коэффициент вариации (CV) 16,64 ± 0,07, отношение сигнал / фон (S / B) 84,69 ± 0,45 и отношение сигнал / шум (S / N) 5,94 ± 0,02. Библиотека из 84,551 структурно разнородных соединений была проверена в двух экземплярах в Национальной лаборатории скрининга региональных центров передового опыта в области биозащиты и возникающих инфекционных заболеваний (NSRB) (Гарвардская медицинская школа), и совпадения были идентифицированы на основе увеличения сигнала люциферазы.Результаты первичного скрининга стандартизировали путем расчета Z-показателя для каждого соединения (рис. S1). Удачные соединения были выбраны на основе минимальных Z-баллов 3 и 2,5 для повторяющихся образцов, что привело к идентификации 264 первичных попаданий (0,3%).

Вторичные скрининговые анализы были выполнены для подтверждения совпадений, идентифицированных на первичном скрининге. Каждое пораженное соединение тестировали на кривой доза-ответ из 10 точек как в присутствии, так и в отсутствие инфекции вирусом гриппа, чтобы отличить те соединения, которые индуцируют IFNβ независимо от вирусного стимула, от тех, которые требуют вирусной инфекции.Это отличалось от первичного скрининга, в котором каждое соединение тестировалось в одной концентрации (350-кратное разбавление исходной концентрации, см. Методы) и только при наличии инфекции вируса гриппа. Было подтверждено, что соединение является успешным, если оно проявляет дозозависимый эффект с минимальной 5-кратной индукцией либо в присутствии, либо в отсутствие инфекции вируса гриппа. Этот процесс привел к отбору 27 соединений, из которых 25 индуцировали индукцию IFNβ независимо от вирусной инфекции, а два индуцировали индукцию IFNβ только в присутствии вирусной инфекции.Поскольку последние два соединения могут вызывать специфический противовирусный иммунный ответ только в инфицированных клетках, ограничивая тем самым нежелательные побочные эффекты, связанные с терапией IFN, их исследовали для дальнейшей характеристики. Мы выбрали ASN2 (рис. 1B) в качестве основного соединения, поскольку это соединение вызывало более устойчивый ответ IFN.

Чтобы изучить потребность в стимуле, специфичном для вируса гриппа, мы проверили способность ASN2 индуцировать экспрессию IFNβ в присутствии вируса гриппа и вируса, не связанного с гриппом, вируса везикулярного стоматита (VSV).ASN2 был способен индуцировать IFNβ в присутствии вируса гриппа A / PR / 8/34, но не VSV (рис. 1C), предполагая, что это соединение требует специфического для вируса гриппа стимула, чтобы индуцировать IFNβ.

ASN2 вызывает противовирусный ответ при инфицировании вирусом гриппа A

Чтобы проверить, что индукция репортера IFNβ-люциферазы, наблюдаемая при первичном и вторичном скринингах, коррелирует с индукцией IFNβ мРНК и связанных IFN-стимулированных генов (ISG) в клетках человека, мы инфицировали клетки карциномы легких (A549) человека вирусом гриппа A / WSN. / 33, обработали их ASN2 или DMSO и исследовали экспрессию генов, связанных с IFN, с помощью qRT-PCR.МРНК IFNβ, ISG56 (IFIT1) и IP10 (CXCL10) были значительно индуцированы в инфицированном образце, обработанном ASN2, и эта индукция со временем увеличивалась (фиг. 2A). Другие гены, протестированные с помощью qRT-PCR, показали аналогичные модели индукции в присутствии ASN2, включая IFNλ-1, -2, -3, CCL5, IRF7, ISG54, MxA, PKR и STAT1 (данные не показаны).

РазвернутьРисунок 2. ASN2 вызывает противовирусный ответ при инфицировании вирусом гриппа А.

(A) Анализ qRT-PCR транскриптов IFNβ, ISG56 и IP10 в клетках A549, инфицированных вирусом гриппа A / WSN / 33 (MOI = 1) и обработанных ASN2 (50 мкМ) в течение 24 часов.Значения были нормализованы к α-тубулину для каждого образца и представлены как кратная индукция по сравнению с неинфицированным DMSO-обработанным образцом (MOCK). Планки погрешностей отражают стандартное отклонение кратного изменения. p <0,05, ** p <0,005, *** p <0,0005 (B) Антивирусный биоанализ клеток A549, инфицированных вирусом гриппа A и обработанных ASN2 в течение 18 часов. Супернатанты этих клеток собирали и инактивировали УФ-излучением перед нанесением их на свежевысаженные клетки VERO в течение 24-часового периода инкубации перед инфицированием NDV-GFP.Графики представляют процент ингибирования NDV-GFP, индуцированного супернатантами, собранными после указанных обработок. Процент ингибирования, индуцированного супернатантами от инфекции вируса Сендай (SeV), был установлен на 100%. Столбцы представляют собой среднее из трех значений ± стандартное отклонение. (C) Глубокий анализ секвенирования мРНК из клеток A549, инфицированных A / WSN / 33 (MOI = 1) и обработанных DMSO или ASN2 (50 мкМ) в течение 24 часов. Показано общее количество считываний, полученных для указанных генов для обработок DMSO и ASN2.* р <0,05.

doi: 10.1371 / journal.ppat.1002668.g002

Более »

Чтобы выяснить, способны ли цитокины, высвобождаемые во время обработки ASN2 инфицированных вирусом гриппа клеток, вызывать защитный противовирусный ответ, мы провели антивирусный биоанализ. Клетки A549 были инфицированы вирусом гриппа и обработаны ASN2 или DMSO. Заражение вирусом Сендай (SeV) Кантелл использовали в качестве положительного контроля для индукции интерферона [25]. Супернатанты собирали через 24 часа, инактивировали ультрафиолетом и затем переносили в наивные клетки VERO (которые не способны продуцировать интерферон, но чувствительны к действию экзогенного интерферона [26], [27], [28]) за 24 часа до этого. к инфицированию вирусом болезни Ньюкасла, экспрессирующим репортер GFP (NDV-GFP).Если супернатанты содержат цитокины, способные вызывать антивирусное состояние, последующее инфицирование NDV-GFP будет ограничено; в противном случае можно было бы ожидать, что рост NDV-GFP будет протекать беспрепятственно. Супернатанты от инфицированных вирусом гриппа клеток, обработанных ASN2, были способны ограничивать рост NDV-GFP в клетках VERO, и этот эффект был прямо пропорционален дозе ASN2 (фиг. 2B). Как и ожидалось, супернатанты от инфицированных вирусом гриппа клеток, обработанных ДМСО, не ограничивали рост NDV-GFP, поскольку инфекция вирусом гриппа дикого типа не индуцирует значительных уровней IFNβ.Примечательно, что супернатанты от неинфицированных обработанных ASN2 клеток показали лишь минимальную способность ограничивать рост NDV-GFP. Поскольку этот анализ измеряет общие противовирусные цитокиновые ответы, а не только IFN типа I, возможно, что ASN2 способен индуцировать некоторые цитокины, не относящиеся к IFN, которые составляют наблюдаемое 20% ингибирование NDV-GFP. В целом эти данные показывают, что только клетки, инфицированные вирусом гриппа и обработанные ASN2, способны выделять цитокины, которые вызывают устойчивое противовирусное состояние в клетках VERO.

Чтобы лучше понять профиль транскрипции генов, затронутых обработкой ASN2, мы выполнили глубокое секвенирование общей мРНК из клеток A549, инфицированных вирусом гриппа A / WSN / 33 и обработанных либо ASN2, либо DMSO. Общее количество считываний последовательности для каждого гена было нормализовано к таковому для GAPDH для каждого образца, поскольку этот ген не подвергался влиянию ASN2 и был одним из самых распространенных. Мы сравнили в общей сложности 15 154 гена, и 34 из них были индуцированы как минимум в 100 раз в образце ASN2 по сравнению с контролем DMSO (Таблица S1).Среди этих индуцированных генов есть несколько известных ISG (рис. 2C), и, в частности, было описано, что некоторые участвуют во врожденном иммунном ответе на вирусные патогены (например, Mx, OAS, IFIh2 (MDA5), BST2 (тетерин), DDX58 (RIGI). )). Этот анализ дополнительно продемонстрировал способность ASN2 индуцировать экспрессию генов, связанных с врожденным иммунным ответом.

Чтобы выяснить, требуется ли репликация вируса для ASN2-опосредованной индукции IFNβ, было выполнено инфицирование УФ-инактивированным вирусом гриппа.Действительно, ASN2 был неспособен индуцировать мРНК IFNβ и ISG56 в присутствии УФ-инактивированного вируса гриппа A, вопреки его эффекту в присутствии репликационно-компетентного вируса (рис. S2). Это указывает на необходимость репликации вируса в индуцирующей IFNβ активности ASN2.

Противовирусная активность ASN2

Чтобы оценить его способность ингибировать репликацию вируса, ASN2 был протестирован при нецитотоксических концентрациях в анализе репликации вируса. Клетки A549 были инфицированы вирусом гриппа A / WSN / 33 (MOI = 0.01) и обрабатывали ASN2 в диапазоне концентраций в течение 48 часов. Снижение вирусных титров на 4,5 log было обнаружено в присутствии 50 мкМ ASN2, и было определено, что IC 50 (концентрация 50% ингибирования) составляет 3 мкМ (фиг. 3A). CC 50 (концентрация цитотоксичности 50%) для ASN2 составляет 300,9 мкМ, что дает селективный индекс (SI = CC 50 / IC 50 ), равный 100,3. Несколько штаммов вирусов гриппа A и B, а также вирусов, не связанных с гриппом (VSV и вирус Sindbis), были протестированы против ASN2.Интересно, что ASN2 был значительно более мощным против вирусов гриппа A, включая ряд штаммов подтипов h2N1, h4N2 и H5N1, и очень эффективно подавлял реконструированный вирус пандемии 1918 года, снижая титры вирусов до 6,2 log (таблица 1). ). Мы отмечаем, что для вирусов, не связанных с гриппом А, ASN2 действительно проявляет некоторую противовирусную активность, но он гораздо более эффективен против вирусов гриппа А. Мы предполагаем, что этот неспецифический противовирусный эффект может быть связан с незначительной индукцией антивирусных цитокинов ASN2, наблюдаемой в антивирусном биоанализе (рис.2Б).

РазвернутьРисунок 3. ASN2 подавляет репликацию вируса гриппа A и проявляет противовирусную активность in vivo и .

(A) Титры вируса из клеток A549, инфицированных вирусом гриппа A / WSN / 33 (MOI = 0,01) и обработанных увеличивающимися концентрациями ASN2 в течение 48 часов (оранжевая кривая). Анализ жизнеспособности клеток A549, обработанных возрастающими концентрациями ASN2 в течение 48 часов (черная кривая). Кривые представляют собой средние значения трех повторностей ± стандартное отклонение. (B) Кривые массы тела и выживаемости мышей BALB / c (группы по 9), инфицированных вирусом гриппа A / WSN / 33 (5LD 50 ) и получавших 100 мг / кг ASN2 каждые 8 ​​часов в течение 8 дней.Соединение вводили внутрибрюшинно за 8 часов до инфицирования. Три мыши из каждой группы были умерщвлены на 3-й и 8-й дни после инфицирования для определения титров вируса в легких (данные не показаны). Кривые представляют собой средние значения ± стандартное отклонение, * p <0,001. Мышей, вес которых упал ниже 75% от их первоначального веса, умерщвляли в соответствии с нашим протоколом для животных.

doi: 10.1371 / journal.ppat.1002668.g003

Более » РазвернутьТаблица 1. Вирусы, протестированные против ASN2.

дой: 10.1371 / journal.ppat.1002668.t001

Более »

Для оценки активности и эффективности ASN2 in vivo мышей BALB / c лечили ASN2 (100 мг / кг / день) каждые 8 ​​часов в течение восьми дней. Первую дозу вводили за 8 часов до заражения вирусом гриппа A / WSN / 33 5MLD 50 . Инфицированные животные, получавшие PBS и обработанные растворителем, умерли от инфекции через 9 дней после заражения (выживаемость 0%), в то время как неинфицированная группа и группа, получавшая озельтамивир (1.5 мг / кг / день) продемонстрировала 100% выживаемость (фиг. 3B). Животные, обработанные ASN2, показали значительно меньшую потерю веса по сравнению с инфицированными животными, обработанными PBS и обработанными растворителем, и это привело к замедленному времени до смерти с 33% выживаемостью до 20 дней после заражения. Мышей из каждой группы умерщвляли на 3-й и 8-й дни после инфицирования и собирали легкие для определения вирусных титров. За исключением группы, получавшей озельтамивир, не наблюдалось значительных различий в титрах легких (данные не показаны).Ограниченная эффективность ASN2 in vivo , возможно, объясняется метаболической нестабильностью. Микросомный анализ печени мыши in vitro и был использован для прогнозирования метаболической стабильности ASN2, и результаты показали высокий внутренний печеночный клиренс (CL int ) 224 мкл / мин / мг белка (нормальный уровень составляет 8,8–48 мкл / мг). мин / мг белка) и очень короткий период полувыведения (t 1/2 ) 6,18 мин. В совокупности эти результаты показывают, что ASN2 частично защищает мышей от летальной инфекции вируса гриппа A, и предполагают, что фармакокинетические свойства ASN2 могут быть оптимизированы для дальнейшего повышения эффективности in vivo .

ASN2 нацелен на функцию полимеразы вируса гриппа А.

Чтобы определить вклад IFN в противовирусную активность ASN2, мы провели анализ ингибирования вируса в клетках A549 и клетках VERO одновременно. Клетки инфицировали вирусом гриппа A / WSN / 33 (MOI = 0,01), а затем обрабатывали увеличивающимися концентрациями ASN2 в течение 48 часов перед измерением титров вируса в супернатантах. Удивительно, но противовирусная активность все еще наблюдалась в клетках VERO, которые, как известно, не способны продуцировать IFN типа I, с незначительными различиями в их концентрациях IC 50 и IC 99 по сравнению с клетками A549 (рис.4А). Такие же результаты были получены при использовании еще более низкой множественности (MOI = 0,0001) в клетках A549 и VERO, что должно было позволить наблюдать любое IFN-опосредованное ингибирование (данные не показаны). Более того, ASN2 также сохранял полную активность в клетках, дефицитных по IRF9, STAT1 или STAT2 (данные не показаны). Эти результаты предполагают, что противовирусная активность ASN2 в культуре ткани не зависит от активности IFN.

РазвернутьРисунок 4. Противовирусная активность ASN2 не зависит от продукции интерферона и NS1.

(A) Титры вирусов из клеток A549 и VERO, инфицированных вирусом гриппа A / WSN / 33 (MOI = 0,01) и обработанных увеличивающимися концентрациями ASN2 (6,25–50 мкМ) в течение 48 часов. (B) Анализ уменьшения бляшек клеток VERO, инфицированных указанными вирусами, в присутствии либо ДМСО, либо ASN2 (50 или 25 мкМ). Бляшки иммуноокрашивали с использованием антитела NP. (C) Вестерн-блоттинг клеточных экстрактов из клеток A549, инфицированных вирусом гриппа A / WSN / 33 (MOI = 1) и обработанных ASN2 (50 мкМ) в течение 24 часов.Для каждого из указанных белков использовали специфические антитела. (D) Репортерный анализ клеток A549, трансфицированных IFNβ-люциферазой и репортерами pRL-TK, пустой плазмидой (-) или уменьшающимися концентрациями NS1 (325, 32,5 и 3,25 нг) в течение 24 часов до инфицирования вирусом гриппа A / WSN. / 33 вирус (MOI = 1). Клетки обрабатывали либо ASN2 (50 мкМ), либо ДМСО, и активность люциферазы определяли через 24 часа после заражения. Значения были нормализованы к активности люциферазы Renilla для каждого образца и представлены как кратная индукция по неинфицированному образцу, обработанному ДМСО (имитация).Столбцы представляют собой средние значения трех значений ± стандартное отклонение.

doi: 10.1371 / journal.ppat.1002668.g004

Более »

Из-за роли белка NS1 вируса гриппа A как мощного антагониста IFN и фасилитатора репликации вируса мы исследовали участие этого белка в противовирусной активности ASN2. Клетки VERO инфицировали вирусом гриппа дикого типа A / PR / 8/34 или вирусом, лишенным NS1 (PR8ΔNS1), в присутствии DMSO или ASN2. Обработка ASN2 значительно снизила количество бляшек по сравнению с обработкой DMSO как для вирусов дикого типа, так и для вирусов ΔNS1 (рис.4B), предполагая, что NS1 не является прямой мишенью для ASN2.

Затем мы исследовали экспрессию вирусного белка в клетках, инфицированных вирусом гриппа, в условиях, когда индукция IFNβ наблюдается в присутствии ASN2. Клетки A549 инфицировали вирусом гриппа A / WSN / 33 (MOI = 1) и обрабатывали 50 мкМ ASN2 в течение 24 часов. Вестерн-блоттинг выявил снижение экспрессии всех исследованных вирусных белков, но это снижение было гораздо более очевидным для белков NS1, M1 и M2 (фиг. 4C). Чтобы связать эту потерю экспрессии NS1 с индукцией IFNβ, наблюдаемой во время обработки ASN2, NS1 экспрессировался из плазмиды в клетках A549, инфицированных вирусом гриппа и обработанных ASN2.Инфицированные клетки, трансфицированные пустой плазмидой, демонстрировали индукцию IFNβ в присутствии ASN2, а не DMSO, как было показано ранее (фиг. 4D). Напротив, индукция IFNβ не наблюдалась в обработанных ASN2 инфицированных клетках, сверхэкспрессирующих NS1. Кроме того, разведение плазмиды NS1 приводило к дозозависимому восстановлению индукции IFNβ в этих клетках. Эти данные предполагают, что потеря экспрессии NS1, которая является результатом ASN2-опосредованного ингибирования вируса, ответственна за наблюдаемую индукцию IFNβ.

Учитывая, что обработка ASN2 приводила к снижению экспрессии вирусного белка, было исследовано влияние ASN2 на репликацию и / или транскрипцию вирусной РНК. Анализ мини-генома вируса гриппа, который измеряет активность вирусного полимеразного комплекса в контексте восстановленного вирусного рибонуклеопротеина, проводили в присутствии или в отсутствие ASN2. Клетки A549 котрансфицировали экспрессирующими плазмидами белков полимеразы вируса гриппа A / WSN / 33 (PB1, PB2 и PA), нуклеопротеином (NP), репортерной плазмидой люциферазы, специфичной для вируса гриппа [29], и трансфекцией. контрольная плазмида.Добавляли ASN2 или DMSO и позволяли трансфекции продолжаться в течение 24 часов перед исследованием активности люциферазы. ASN2 сильно ингибировал репортер мини-генома вируса гриппа в зависимости от дозы, не влияя на экспрессию контрольного репортера, что позволяет предположить, что на функцию полимеразы вируса гриппа влияет ASN2 (фиг. 5A).

РазвернутьРисунок 5. ASN2 подавляет синтез вирусной РНК.

(A) Активность мини-генома вируса гриппа A в клетках A549, трансфицированных репортером мини-генома люциферазы светлячка вируса гриппа, контрольным репортером pRL-TK, плазмидами, экспрессирующими белок PB1, PB2, PA и NP.Во время трансфекции проводили обработку ДМСО или увеличивающимися концентрациями ASN2 (6,25–50 мкМ). Люциферазную активность анализировали через 24 часа после трансфекции. Значения люциферазы Firefly и Renilla представлены в виде% активности от имитационного (минигенома без экспрессии NP) относительно контроля ДМСО. Планки погрешностей отражают стандартное отклонение% активности. (B) Анализ удлинения праймера мРНК и вРНК вируса гриппа из клеток A549, инфицированных вирусом гриппа A / WSN / 33 (MOI = 5) и обработанных ДМСО или уменьшающимися концентрациями ASN2 (50–12.5 мкМ) в течение 6 часов. Были проанализированы сегменты PB2, NA и NS. Рибавирин (100 мкМ) использовали в качестве положительного контроля, а 5S рРНК использовали в качестве контроля загрузки. Количественная оценка экспрессии мРНК и вРНК, нормализованная к 5S рРНК, показана справа.

doi: 10.1371 / journal.ppat.1002668.g005

Более »

Эти данные были дополнены выполнением анализов удлинения праймеров для анализа влияния ASN2 на различные виды РНК вируса гриппа. Клетки A549 инфицировали вирусом гриппа A / WSN / 33 (MOI = 5) и обрабатывали ASN2 в течение 6 часов до сбора общей РНК.Была проанализирована продукция мРНК и вРНК из трех репрезентативных сегментов генома гриппа, PB2, NA и NS. Лечение рибавирином было включено в качестве контроля. Для всех трех сегментов синтез вРНК ингибировался ASN2 дозозависимым образом, тогда как синтез мРНК снижался в сегментах NA и NS, но не в сегменте PB2 (рис. 5B). Напротив, контрольный рибавирин подавлял все три сегмента в равной степени. На основании этих результатов мы предполагаем, что ASN2 ингибирует функцию полимеразы способом, который подавляет синтез вРНК из всех сегментов, и что он также нарушает продукцию мРНК, но, возможно, сегмент-специфическим образом.

Влияние ASN2 на синтез вирусной мРНК было подтверждено путем анализа транскрипционного профиля вирусной мРНК, полученного путем глубокого секвенирования инфицированных клеток, обработанных ASN2 или DMSO, как описано ранее. Наблюдался поразительный сегмент-зависимый эффект на продукцию вирусной мРНК в образце, обработанном ASN2 (рис. S3). Примечательно, что транскрипция из меньших сегментов, M и NS, ингибировалась в наибольшей степени, что коррелировало с результатами анализа удлинения праймера и вестерн-блоттинга, показывающими, что на уровни мРНК и белка из меньших сегментов обработка ASN2 сильнее, чем у тех от более крупных.Очевидное увеличение экспрессии мРНК было замечено с более крупными сегментами (PB2, PB1, PA) в присутствии ASN2 (рис. S3).

Чтобы определить, является ли мишень ASN2 вирусным белком, мы попытались отобрать ускользающий мутантный вирус гриппа ASN2. Устойчивый вирус выделяли в четырех пассажах, и полное секвенирование вирусного генома выявило одно изменение аминокислоты с тирозина (Y) на гистидин (H) в положении 499 белка PB1 (PB1-Y499H). Чтобы подтвердить, что мутация PB1-Y499H действительно придает устойчивость к ASN2, мы сконструировали эту мутацию в рекомбинантный вирус гриппа A / WSN / 33 (rWSN PB1-Y499H) с использованием обратной генетики [30].Мутация PB1-Y499H не влияла на нормальные ростовые свойства вируса (данные не показаны) и, в отличие от вируса дикого типа, rWSN PB1-Y499H был устойчивым к обработке ASN2 (рис. 6A-B). Кроме того, экспрессия Профили мРНК IFNβ, ISG56, M1 и NS1 не были затронуты обработкой ASN2 клеток, инфицированных вирусом rWSN PB1-Y499H, тогда как индукция IFNβ и ISG56 и ингибирование M1 и NS1 наблюдались в присутствии инфекции rWSN (рис. 6C – D).

РазвернутьРисунок 6. Мутация Y499H в белке PB1 придает устойчивость к ASN2.

(A) Анализ уменьшения бляшек клеток MDCK, инфицированных указанными вирусами, в присутствии либо ДМСО, либо ASN2 (50 мкМ). Бляшки окрашивали антителом против NP. (B) Титры вирусов из клеток MDCK, инфицированных указанными вирусами и обработанных увеличивающимися концентрациями ASN2 в течение 48 часов. Кривые представляют собой средние значения трех повторностей ± стандартное отклонение. (C – D) qRT-PCR анализ мРНК IFNβ, ISG56, NS1 и M1 из клеток A549, инфицированных указанными вирусами (MOI = 1) и обработанных ASN2 (50 мкМ) в течение 24 часов.Значения в (C) были нормализованы к α-тубулину для каждого образца и представлены как кратная индукция по сравнению с неинфицированным образцом, обработанным ДМСО. Значения в (D) представлены как кратная индукция для инфицированного образца, обработанного ДМСО. Планки погрешностей отражают стандартное отклонение кратного изменения. (E) Активность мини-генома вируса гриппа A в клетках 293T, трансфицированных репортером мини-генома вируса гриппа A, контрольным репортером pRL-TK, плазмидами, экспрессирующими белок wtPB1 или PB1-Y499H, PB2, PA и NP. Обработка ДМСО или увеличивающихся концентраций ASN2 (12.5–50 мкМ) во время трансфекции. Люциферазную активность анализировали через 24 часа после трансфекции. Значения были нормализованы к активности люциферазы Renilla для каждого образца и представлены как% активности относительно контроля (минигеном без экспрессии PB1). Планки погрешностей отражают стандартное отклонение% активности. (F) Активность мини-генома вируса гриппа B в клетках A549, трансфицированных репортером мини-генома вируса гриппа B CAT, контрольным репортером pRL-TK, плазмидами, экспрессирующими белок wtPB1 или PB1-D498Y, PB2, PA и NP.Клетки обрабатывали ДМСО или 50 мкМ ASN2. Активность CAT и люциферазы измеряли через 24 часа после трансфекции, и в каждом случае показан нормализованный% активности мини-генома для дикого или мутантного PB1 относительно контроля DMSO.

doi: 10.1371 / journal.ppat.1002668.g006

Более »

Чтобы убедиться, что мутация PB1-Y499H придает устойчивость к ASN2 путем восстановления нормального синтеза вирусной РНК, мы выполнили анализ мини-генома вируса гриппа с использованием vRNP, восстановленных либо с помощью PB1 дикого типа, либо с помощью PB1-Y499H.ASN2 ингибировал функцию полимеразы в анализе мини-генома с использованием PB1 дикого типа, но не мутантного белка PB1-Y499H (фиг. 6E). В совокупности эти результаты подтвердили, что устойчивость к ASN2 была обусловлена ​​мутацией одной аминокислоты в белке PB1, и убедительно предположили, что вирусной мишенью ASN2 был белок PB1 вируса гриппа А.

Мы исследовали сохранение остатка 499 среди нескольких вирусов гриппа человека А с использованием исследовательской базы данных вирусов гриппа (IRD) [31].Было проанализировано более 6000 вирусов трех различных подтипов вируса гриппа A, и большинство из них содержало серин (S) или тирозин (Y) в положении 499 белка PB1, за исключением одного вируса A / h4N2, который содержал фенилаланин ( F) (Таблица S2). Это указывает на то, что остаток 499 PB1 является высококонсервативным среди вирусов гриппа A, что коррелирует со способностью ASN2 ингибировать все вирусы гриппа A, исследованные в этом исследовании. Соответствующим положением аминокислоты в белке PB1 вирусов гриппа B является аспарагиновая кислота (D498), что может объяснить относительно неэффективную противовирусную активность ASN2, наблюдаемую в отношении вируса гриппа B (таблица 1).Неожиданно было обнаружено, что мутация остатка D498 в Y делает полимеразу вируса гриппа B чувствительной к ингибированию ASN2, как видно из анализа мини-генома (фиг. 6F), хотя эта мутантная полимераза была менее активна, чем полимераза, содержащая дикую природу. -типа PB1.

Исследование положения этой аминокислоты в полимеразах всех сегментированных вирусов с отрицательной цепью РНК показывает, что она находится в непосредственной близости (на 5 остатков ниже) к Motif E, который является высококонсервативной областью [32]. Тем не менее, остаток в этом положении различается между вирусами, и ни один другой вирус не обладает тирозином или серином, как вирусы гриппа А.Опять же, это коррелирует с нашим выводом о том, что ASN2 более специфичен для вирусов гриппа А.

Обсуждение

Мы разработали клеточный высокопроизводительный скрининговый анализ, который определяет соединения с малой молекулярной массой, которые способны восстанавливать эндогенный противовирусный ответ на клетки, инфицированные вирусом гриппа. В этом процессе мы идентифицировали две группы соединений, индуцирующих IFNβ. Первая группа включает 25 соединений, которые индуцируют IFNβ независимо от вирусного стимула, в то время как вторая группа состоит из двух соединений, которые индуцируют IFNβ только в присутствии вируса.Из последней группы ASN2 был выбран в качестве ведущего соединения из-за его превосходной способности индуцировать экспрессию IFN типа I и ISG и тем самым устанавливать антивирусное состояние; желательная особенность противовирусных препаратов, направленных против вирусов, чувствительных к действию IFN. Этот ответ очень специфичен для вируса гриппа и требует репликации вируса. Транскрипционное профилирование инфицированных вирусом гриппа клеток, обработанных ASN2, подтвердило способность этого соединения индуцировать множество генов, многие из которых являются известными ISG с мощной противовирусной функцией.Однако потребуется более глубокий анализ этих данных, чтобы полностью понять спектр клеточных генов, индуцируемых ASN2, которые могут способствовать его противовирусной активности. Кроме того, мы подтвердили биологическую активность цитокинов, индуцированных ASN2, в антивирусном биоанализе, что указывает на то, что этот ответ способен защищать соседние неинфицированные клетки.

ASN2 обладает мощной противовирусной активностью против нескольких подтипов вируса гриппа A, включая несколько пандемических штаммов, которые были связаны с тяжелыми заболеваниями человека.Эта противовирусная активность опосредует частичную защиту мышей от смертельной дозы вируса гриппа A, свойство, которое, вероятно, может быть дополнительно улучшено с помощью оптимизации медицинской химии ASN2 для обеспечения оптимальных фармакокинетических свойств. Учитывая сильную способность ASN2 индуцировать IFN, мы были особенно удивлены, обнаружив, что соединение сохраняет свою противовирусную активность в клетках Vero, что указывает на то, что его противовирусный механизм не зависит от IFN типа I. Таким образом, оказалось, что активация врожденного иммунного ответа была вторичной по отношению к более прямой противовирусной функции.Способность ASN2 ингибировать активность мини-генома вируса гриппа предполагает, что функция вирусной полимеразы может быть мишенью соединения. Создание вируса, устойчивого к ASN2, показало важность остатка тирозина в положении 499 белка PB1 для противовирусной активности ASN2.

Позиция 499 белка PB1 занята тирозином или серином практически во всех штаммах вируса гриппа A, но не в полимеразах других сегментированных вирусов с отрицательной цепью, включая белки PB1 вирусов гриппа B и C, которые имеют аспарагиновая кислота и глицин соответственно в этом положении.Эта вариабельность объясняет наблюдаемый спектр противовирусной активности ASN2, и мы продемонстрировали, что полимераза вируса гриппа B, которая от природы нечувствительна к ASN2, может быть сделана чувствительной к ASN2 путем простой замены аспарагиновой кислоты дикого типа на тирозин. Возникает соблазн предположить, что потребность в остатке тирозина или серина является показателем того, что эти остатки являются мишенями для фосфорилирования и что ASN2 каким-то образом мешает этой модификации, хотя присутствие гистидина в устойчивом мутанте может не поддерживать эту теорию.Следует отметить, что PB1 фосфорилируется протеинкиназой C, но целевой остаток не идентифицирован [33]. Тем не менее, наши данные определенно указывают на функциональную роль этой конкретной области белка PB1, которая до сих пор не выяснена. Быстрое формирование устойчивости является убедительным признаком того, что PB1 является прямой мишенью для ASN2 (в отличие от клеточного белка), но это должно быть официально подтверждено с помощью анализов связывания in vitro и . К сожалению, эта область PB1 не покрывается доступными кристаллическими структурами PB1, поэтому попытки моделирования in silico в настоящее время невозможны.

Несмотря на ингибирующие эффекты ASN2 на функцию полимеразы в анализе мини-генома, при анализе экспрессии вирусных генов на уровне как мРНК, так и белка стало ясно, что не все гены затронуты одинаково. В частности, экспрессия генов, кодируемых самыми маленькими сегментами генома, M и NS, подавляется сильнее. Подавление экспрессии белка NS1 сразу же привело нас к вопросу, было ли это причиной ASN2-опосредованной индукции IFN, и добавление плазмид-экспрессируемого NS1 показало, что это действительно так.Таким образом, индукция IFN, наблюдаемая в обработанных ASN2 клетках, инфицированных вирусом гриппа, по-видимому, связана с потерей экспрессии NS1, которая является вторичной по отношению к специфическому ингибирующему эффекту ASN2 на функцию вирусной полимеразы. Очевидно, будет важно оценить последствия снижения экспрессии M1, M2 и NEP и определить, как они могут способствовать противовирусной активности ASN2. В частности, было показано, что NEP является ключевым регулятором вирусной транскрипции и репликации, а отсутствие NEP может способствовать противовирусному действию ASN2, возможно, благодаря его роли в продукции svRNAs [34], [35].

Насколько нам известно, дифференциальная экспрессия вирусного гена на основе длины сегмента не была описана для вируса гриппа. Скорее, сообщалось, что некоторые гены преимущественно экспрессируются на ранней стадии (NP и NS1), а другие — на поздней стадии заражения (M1) [36], [37], однако этот образец явно не коррелирует с тем, что мы наблюдали в присутствии ASN2. где имело место преимущественное подавление экспрессии мРНК из более мелких сегментов (M1, M2, NS1, NEP). Этот эффект, по-видимому, специфичен для транскрипции, поскольку не наблюдалось сегмент-зависимого ингибирования синтеза вРНК.Хотя по совпадению сегменты M и NS также являются теми, которые производят сплайсинговые продукты, мы не думаем, что ASN2 специфически влияет на сплайсинг, поскольку мы наблюдаем аналогичное снижение белков, экспрессируемых как из сплайсированных (M2, NEP), так и из несплайсированных (M1, NS1) транскриптов . В отсутствие лучшего понимания регуляции вирусной транскрипции эти данные трудно интерпретировать, но они могут указывать на роль PB1 (или одного из продуктов меньшего вирусного гена) в регуляции синтеза мРНК сегментно-зависимым образом.В этом смысле ASN2 может служить полезным инструментом для дальнейшего исследования этого явления.

Следует отметить, что возможность отбора устойчивых к ASN2 мутантов в культуре ткани не обязательно оказывает негативное влияние на будущее ASN2 как кандидата в противовирусные препараты. Аналогичные результаты были получены в отношении осельтамивира, который является очень успешным препаратом против вируса гриппа [38], [39]. Более того, вполне вероятно, что в будущем методы лечения гриппа будут включать комбинации лекарств, которые действуют через различные механизмы, тем самым снижая вероятность лекарственной устойчивости.В этом отношении идентификация ASN2 как ингибитора полимеразы дополняет текущий класс ингибиторов нейраминидазы. На сегодняшний день было опубликовано только одно сообщение о противовирусном препарате гриппа, нацеленном на PB1 [40]. Это соединение структурно отличается от ASN2, а также генерирует другую мутацию устойчивости (h556P), но без трехмерной структуры мы не можем предсказать, находятся ли аминокислоты 499 и 456 в непосредственной близости. Способность ASN2 индуцировать IFN типа I является уникальным свойством для вирус-направленного соединения и сочетает в себе как ингибирующую вирусную активность, так и активность иммунной активации в одной молекуле.Мы полагаем, что способность ASN2 предпочтительно ингибировать экспрессию NS1 является причиной его свойств индукции IFN и что другие ингибиторы функции полимеразы вируса гриппа, которые действуют одинаково на все сегменты, не будут индуцировать IFN. Короче говоря, ASN2 вызывает дисбаланс в синтезе RIG-I-стимулирующей РНК по сравнению с NS1, тогда как противовирусные соединения, влияющие на все сегменты, подавляют как продукцию стимула RIG-I, так и NS1. В подтверждение этого мы показали, что A3, противовирусное соединение широкого спектра действия, которое истощает пулы пиримидина и предотвращает весь синтез вирусной РНК [41], не индуцирует IFN (рис.S4). Хотя это не является существенным для противовирусного действия в культуре ткани, индукция IFN может оказаться полезной в условиях in vivo , возможно, облегчая активацию адаптивного иммунного ответа и вирусный клиренс, что будет дополнительно изучено с использованием IFNAR — / — мышей. . Нацеленная продукция IFN (то есть происходящая только в инфицированных вирусом гриппа клетках) также обеспечивает явные преимущества по сравнению с терапией экзогенным IFN, которая часто связана с неприятными побочными эффектами.

Материалы и методы

Клеточные культуры и реагенты

Эпителиальные клетки собачьей почки Madin-Darby (MDCK), клетки альвеолярного эпителия человека (A549), клетки эмбриональной почки человека 293T (293T) и клетки почек африканской зеленой мартышки (VERO) были получены из Американской коллекции типовых культур (ATCC). , Манассас, Вирджиния). MDCK, стабильно экспрессирующий репортер IFNβ-люциферазы (MDCK IFNβ-люцифераза) [23], были любезно предоставлены Адольфо Гарсиа-Састре (Медицинская школа Mount Sinai, Нью-Йорк, Нью-Йорк).Клетки MDCK, A549, 293T и VERO культивировали в среде Игла, модифицированной Дульбекко (DMEM) (Gibco, Карлсбад, Калифорния), с добавлением 10% фетальной телячьей сыворотки (FBS) (HyClone, South Logan, UT) и 1% пенициллина. стрептомицин (P / S) (Gibco). Клетки MDCK IFNβ-люциферазы культивировали в среде DMEM с добавлением 10% FBS, 1% P / S, 0,5 мг / мл гигромицина B (Invitrogen, Carlsbad, CA) и 2 мг / мл Geneticin (Invitrogen). Все клетки выращивали при 37 ° C, 5% CO 2 .

Обработку клеток β-интерфероном человека (IFNβ) (PBL Interferon Source, Piscataway, NJ) проводили, как описано в тексте.Трансфекцию ДНК и РНК проводили в сывороточной среде с пониженным содержанием Opti-MEM I (Opti-MEM) (Gibco) с липофектамином LTX (Invitrogen) в клетках A549 в соответствии со спецификациями производителя. Для измерения продукции люциферазы в репортерных анализах использовали систему анализа люциферазы Dual-Glo (Promega, Fitchburg, WI). Систему анализа люциферазы Bright-Glo использовали для высокопроизводительного первичного скрининга и подтверждающего скрининга (Promega, Fitchburg, WI).

Экспрессионные плазмиды и клонирование

Репортер pRL-TK (Promega) содержит ген люциферазы Renilla , регулируемый промотором тимидинкиназы вируса простого герпеса.Плазмиды экспрессии млекопитающих, кодирующие белок WSN NS1 и репортер люциферазы светлячка (pGL4.17, Promega) под регуляцией промотора IFNβ (IFNβ-LUC), были любезно предоставлены Адольфо Гарсиа-Састре (Медицинская школа Mount Sinai, Нью-Йорк). , Нью-Йорк). Репортер минигенома вируса гриппа A (pPolI NP_Luc) был создан, как описано ранее [29].

Плазмида спасения вируса гриппа pPolI-PB1 Y499H была создана путем замены одного нуклеотида в родительской плазмиде pPolI-PB1 с использованием набора для сайт-направленного мутагенеза QuickChange (Agilent Technologies, Wilmington, DE) с использованием специфических праймеров (вперед: 5′-CACTAAGTTTCTATTGTGTCGCC 3 ′; обратный: 5′-GCTGAAATTGGCAACAAACCCATGACGATAGAAAAAACTTGTG-3 ′).Наличие мутации было подтверждено секвенированием (Genewiz, South Plainfield, NJ). Вектор экспрессии млекопитающих pCAGGS, содержащий промотор куриного β-актина, был описан ранее [42]. Плазмида экспрессии, кодирующая мутацию PB1 Y499H, была получена путем переваривания плазмид pPolI PB1 Y499H и pCAGGS-PB1 ферментами MfeI и AgeI (New England Biolabs, Ipswich, MA). Расщепленную вставку, содержащую мутацию Y499H, вставляли в расщепленную плазмиду pCAGGS-PB1. Правильная вставка и наличие мутации было подтверждено секвенированием (Genewiz).Плазмида экспрессии pCAGGS, содержащая мутацию D498Y в PB1 вируса гриппа B / Yamagata / 88, была получена посредством сайт-направленного мутагенеза с использованием следующих праймеров:

Вперед: 5′-GAATTTACAAGCATGTTCTATAGATATGGATTTGTATCTAATTTTGCAA

Реверс: 5′-TTGCAAAATTAGATACAAATCCATATCTATAGAACATGCTTGTAAATTC

Вирусы

Вирус гриппа A / WSN / 33 (h2N1) (WSN) размножали в клетках MDCK в течение 2 дней при 37 ° C. Вирус гриппа A / California / 04/2009 (h2N1) размножали в клетках MDCK в течение 3 дней при 35 ° C.Вирус гриппа rA / Brevig Mission / 1/1918 (h2N1), несущий сегмент HA из A / South Carolina / 1/1918, размножался в клетках MDCK в течение 2 дней при 37 ° C. Эксперименты с этим вирусом проводились в условиях повышенного уровня биобезопасности 3 в соответствии с рекомендациями CDC. Вирусы гриппа A / Puerto Rico / 8/1934 (h2N1) (rPR8), A / Hong Kong / 1/1968 (h4N2), A / Udorn / 307/1972 (h4N2), A / USSR / 90/1977 (h2N1) , A / swine / Texas / 4199-2 / 1998 (h4N2) и rA / Vietnam / 1203/2004 (H5N1), несущие мутантный многоосновный сайт расщепления в сегменте HA, и NDV-GFP размножались в 10-дневных эмбрионах. куриные яйца 2 дня при 37 ° С.Вирус Сендай Cantell (SeV) размножали в куриных яйцах с 8-дневными эмбрионами в течение 2 дней при 37 ° C. Вирус гриппа B / Yamagata / 16/1988 размножали в куриных яйцах с 8-дневными эмбрионами в течение 3 дней при 33 ° C. Вирус гриппа rPR8 NS1-113 размножался в куриных яйцах с 7-дневными эмбрионами в течение 2 дней при 37 ° C [21]. Спасение NDV-GFP было описано ранее [43]. Все вирусы гриппа были титрованы с помощью стандартного анализа бляшек в клетках MDCK. Вирус Синдбис (SinV) и вирус везикулярного стоматита, экспрессирующие белок зеленой флуоресценции (VSV-GFP), были любезно предоставлены Джоном Хискоттом (Университет Макгилла, Монреаль, Квинсленд, Канада) и были выращены и титрованы с помощью анализа бляшек в клетках VERO.

Рекомбинантные вирусы гриппа были созданы с использованием протокола спасения от вирусов гриппа, как описано ранее [30]. Вкратце, клетки 293T трансфицировали восемью конструкциями pPolI, экспрессирующими геномные сегменты PB1 (или PB1 Y499H), PB2, PA, NP, HA, NA, M и NS, а также плазмидами экспрессии pCAGGS, кодирующими PB1, PB2, PA и Белки NP. Через 24 часа после трансфекции клетки MDCK культивировали совместно с трансфицированными 293T в течение дополнительных 24–48 часов, пока не наблюдались цитопатические эффекты.Новые вирусы собирали и очищали от бляшек, а наличие мутации подтверждали секвенированием.

Соединения с низкой молекулярной массой

Все соединения были предоставлены и проверены Национальной лабораторией скрининга для региональных центров передового опыта в области биозащиты и новых инфекционных заболеваний (NSRB) (Гарвардская медицинская школа, Бостон, Массачусетс). Были проверены следующие библиотеки: Biomol ICCB Known Bioactives2 Library (480 соединений; BIOMOL, Plymouth Meeting, PA), NINDS custom collection 2 (1040 соединений; MicroSource Discovery Systems, Gaylorsville, CT), Prestwick1 Collection (1120 соединений; Prestwick Chemical, Inc., Вашингтон, округ Колумбия), ActiMol Tim Tec 1 (8518 соединений; TimTec Inc., Ньюарк, Делавэр), Asinex 1 (12 378 соединений; Asinex Corp., Уинстон-Салем, Северная Каролина), Bionet 2 (1700 соединений; Ryan Scientific, Mount Pleasant, SC), Chembridge 3 (10560 соединений; ChemBridge Corp., Сан-Диего, Калифорния), ChemDiv 2 (8560 соединений; ChemDiv, Inc., Сан-Диего, Калифорния), ChemDiv 4 (1320 соединений; ChemDiv, Inc., San Диего, Калифорния), Enamine 2 (26 576 соединений; ENAMINE Ltd., Киев, Украина), Life Chemicals 1 (3893 соединения; Life Chemicals Inc., Burlington, ON), Maybridge 4 (4576 соединений; Maybridge Ltd., Trevillett, England), Maybridge 5 (3212 соединений; Maybridge Ltd., Trevillett, England), Mixed Commercial Plate 5 (268 соединений из библиотек ChemDiv и Maybridge), Peakdale 2 (352 соединения; Peakdale Molecular Ltd. Чапел-эн-ле-Фрит, Хай-Пик, Великобритания). Химические библиотеки хранили при -20 ° C в осушенных контейнерах для хранения. Соединения растворяли в 100% диметилсульфоксиде (ДМСО) в концентрации 2 мг / мл для библиотеки Prestwick1, 10 мМ для библиотеки NINDS и 5 мг / мл для остальных библиотек.Коэффициент разбавления сита составлял 350 раз.

Для вторичных анализов удачные соединения были приобретены непосредственно у указанных поставщиков и растворены в 100% ДМСО. Конечная концентрация ДМСО в культуральной среде не превышала 0,5%.

Высокопроизводительный скрининговый анализ

Скрининг проводили в двух экземплярах, используя твердые белые 384-луночные планшеты. Клетки MDCK IFNβ-люциферазы культивировали до 90% конфлюэнтности, промывали фосфатно-солевым буфером (PBS) (Invitrogen), трипсинизировали 0.05% трипсин-ЭДТА (Invitrogen) и ресуспендировали в среде роста DMEM без фенола красного (Invitrogen) с добавлением 5% FBS и 1% P / S в концентрации 2 × 10 5 клеток / мл. С помощью автоматического наполнителя планшетов 30 мкл разведенной суспензии клеток MDCK IFNβ-люциферазы засевали в каждую лунку 384-луночного планшета (6000 клеток / лунку) и инкубировали при 37 ° C, 5% CO 2 в течение 20 минут. часы. Затем добавляли соединения (100 нл), используя робот для переноса игл Epson (Epson America, Long Beach, CA), и инкубировали при 37 ° C, 5% CO 2 в течение 2 часов.Затем клетки инфицировали rPR8 (MOI = 10), добавляя 5 мкл инокулята вируса (среда + 1 мкг / мл TPCK) непосредственно в среду. Две колонки с правой стороны каждой чашки были зарезервированы для контролей и не содержали соединений. Предпоследняя колонка была инфицирована только вирусом rPR8 (отрицательный контроль), а последняя колонка была инфицирована только вирусом rPR8 NS1-113 (положительный контроль). Заражение продолжалось при 37 ° C, 5% CO 2 в течение 18 часов до измерения продукции люциферазы. 35 мкл реагента Bright-Glo (разбавленного в 3 раза PBS, как описано выше) добавляли в каждую лунку и измеряли сигнал люминесценции с помощью планшет-ридера EnVision.Расчет Z-Score и отбор совпадений описаны в разделе «анализ данных».

Анализ данных

Чтобы оценить надежность наших анализов, мы рассчитали Z’-фактор [24]. Расчеты производились по следующей формуле: Z ′ = 1 — ((3δ pos + 3δ neg ) / (μ pos −μ neg )), где μ pos — средний сигнал для положительного контроля (инфекция rPR8 NS1-113) μ neg — средний сигнал для отрицательного контроля (инфекция rPR8), δ pos — стандартное отклонение положительного контроля, а δ neg — стандарт отклонение для отрицательного контроля.Воспроизводимый Z’-фактор> 0,5 считается оптимальным для HTS. Процентный коэффициент вариации:% CV = δ pos / μ pos * 100, отношение сигнал / фон: S / B = μ pos / μ neg , а отношение сигнал / шум соотношение: S / N = (μ pos −μ neg ) / ((δ pos ) ∧2 + (δ neg ) ∧2) ∧1 / 2.

Анализ результатов, полученных при скрининге соединений, проводили в Microsoft Office Excel с использованием расчета Z-Score для стандартизации каждого сигнала соединения.Формула Z-Score указывает, на сколько стандартных отклонений конкретное соединение выше или ниже среднего значения на планшете, и рассчитывается следующим образом: Z-Score = (x − μ) / δ, где x — исходный сигнал, μ — средний сигнал всех лунок одного планшета, содержащих соединение, и δ — стандартное отклонение всех лунок одного планшета, содержащих соединение. Первичные совпадения определялись путем расчета Z-балла для каждого соединения и применения критериев выбора совпадений: соединение считалось попаданием, если в одном экземпляре Z-балл> 3, а в другом экземпляре Z-балл> 2.5.

В анализах жизнеспособности клеток относительную метаболическую активность АТФ рассчитывали по следующей формуле:% АТФ = (x / μ neg ) * 100, где x — исходный сигнал для каждого соединения, а μ neg — средний сигнал для отрицательного контроля (клетки, обработанные ДМСО). Этот расчет нормализует клетки, обработанные ДМСО (отрицательный контроль), до 100% активности АТФ.

Анализ подтверждающего скринингового анализа проводили с использованием вычисления кратной индукции для нормализации сигнала каждого соединения.Была использована следующая формула: Индукция складывания = x / μ neg , где x — исходный сигнал для каждого соединения, а μ neg — средний сигнал для отрицательного контроля (либо обработка DMSO для клеток, обработанных соединением, либо DMSO инфекция, леченная (rPR8, WSN или VSV) для инфекций, леченных соединениями). Подтвержденные совпадения были отобраны путем расчета кратной индукции для каждого соединения и применения критериев отбора: соединение было подтверждено, если оно проявляло дозозависимый эффект с минимальной 5-кратной индукцией либо в присутствии, либо в отсутствие инфекции вируса гриппа (rPR8).

Анализ жизнеспособности клеток

Анализ жизнеспособности клеток CellTiterGlo (Promega) был использован для определения уровней АТФ как функции жизнеспособности клеток в соответствии со спецификациями производителя. Клетки высевали в 96-луночные планшеты (7500 клеток / лунку) и инкубировали при 37 ° C, 5% CO 2 в течение 24 часов. Затем культуральную среду заменяли 50 мкл свежей среды, содержащей соединение (серийно разведенную), и эту среду дополнительно инкубировали в течение 48 часов. Продукцию люциферазы измеряли, добавляя 50 мкл реагента CellTiterGlo (разбавленного в 2 раза PBS) в каждую лунку, и сигнал люминесценции считывали с использованием планшет-ридера Beckman.Относительную метаболическую активность АТФ рассчитывали, как описано в разделе «анализ данных».

Подтверждающий экранный анализ

Подтверждение первичных совпадений было сделано с повторно заказанными соединениями у коммерческих поставщиков, как описано в разделе «соединения с малой молекулярной массой». Клетки MDCK IFNβ-люциферазы помещали в 96-луночные планшеты с 50 мкл клеток (3 × 10 5 клеток / мл) и инкубировали в течение 20 часов. Было сделано десять серийных разведений соединений в 100% ДМСО, начиная с наивысшей нетоксичной растворимой концентрации.Серийные разведения в ДМСО дополнительно разводили в 200 раз в постинфекционной среде (DMEM с добавлением 0,1% FBS, 1% P / S, 0,5% BSA, 1 мкг / мл TPCK) для получения конечной концентрации DMSO 0,5%. Затем их добавляли к клеткам в 96-луночном планшете, исключая внешние лунки (всего 60 лунок), и инкубировали в течение 2 часов перед инфицированием. Верхняя половина планшета (30 лунок) была оставлена ​​незараженной, а нижняя половина была инфицирована rPR8 (MOI = 10), WSN (MOI = 1) или VSV (MOI = 0,01) путем добавления 10 мкл вирусного инокулята. (PBS с добавлением 0.5% BSA и 1% P / S) непосредственно в среду. Каждое условие было проверено в трех экземплярах. Мок-планшеты, инфицированные rPR8 NS1-113 или не инфицированные, использовали в качестве контролей. Заражение продолжалось при 37 ° C, 5% CO 2 в течение 18 часов перед измерением продукции люциферазы путем добавления 50 мкл реагента Bright-Glo (разбавленного в 3 раза PBS) в каждую лунку. Сигнал люминесценции измеряли с помощью планшет-ридера Beckman. Индукция складки рассчитывалась, как описано в разделе «Анализ данных».

Заражение клеток в присутствии ингибиторов

Для проверки влияния соединений на многоцикловую репликацию вируса гриппа клетки высевали в 6-луночные планшеты при 5 × 10 5 клеток / лунку или 12-луночные планшеты при 2 × 10 5 клеток / лунку и инкубировали. при 37 ° C, 5% CO 2 в течение 24 часов.Затем клетки промывали PBS и инфицировали указанным вирусом в заражающей среде PBS / 0,5% BSA при MOI = 0,01 (если не указано иное) в посевном материале объемом 200 мкл. После 1 часа инкубации при комнатной температуре инокулят вируса аспирировали, клетки промывали PBS, добавляли постинфекционную среду (с 1 мкг / мл TPCK), содержащую соединение, и инкубировали в течение 48 часов во время инфицирования вирусом гриппа и SinV. и в течение 18 часов во время VSV. Вирусные титры вирусов гриппа определяли стандартным анализом бляшек в клетках MDCK.Вирусные титры VSV и SinV определяли стандартным анализом бляшек в клетках VERO.

Чтобы проверить влияние ASN2 на индукцию IFN, клетки инфицировали при MOI = 1 и инкубировали с постинфекционной средой, содержащей соединение, в течение 24 часов. Конечная концентрация ASN2 составляла 50 мкМ, если не указано иное.

Выделение РНК
Экстракцию

РНК клеток для последующего анализа qRT-PCR проводили с использованием набора RNeasy Mini Kit (Qiagen, Valencia, CA) в соответствии со спецификациями производителя.Экстракцию РНК для глубокого секвенирования проводили с использованием реагента TRIzol (Invitrogen) в соответствии со спецификациями производителя. Экстракцию вирусной РНК проводили с использованием набора QIAamp Viral RNA Mini (Qiagen) в соответствии со спецификациями производителя. Выходы РНК оценивали с помощью спектрофотометра Nanodrop (Nanodrop technologies, Wilmington, DE).

ОТ-ПЦР и количественная ОТ-ПЦР (qRT-PCR)

Двухэтапная кОТ-ПЦР была проведена для анализа клеточных и вирусных генов.Синтез первой цепи выделенной РНК осуществляли путем обратной транскрипции с использованием обратной транскриптазы Superscript III (Invitrogen), случайных праймеров (Invitrogen) и RNase Out (Invitrogen) в соответствии со спецификациями производителя. Полученную кДНК разводили до 2–5 нг / мкл в воде для ПЦР и использовали для количественной ПЦР с использованием реагента LightCycler 480 SYBR Green I Master (Roche) и прибора LightCycler 480 (Roche) в соответствии со спецификациями производителя. Анализ результатов проводился с использованием метода 2 -ΔΔCT (двух дельта дельта CT) [44].Мы рассчитали значения ΔΔC T в повторностях с использованием α-тубулина в качестве эндогенного гена домашнего хозяйства и обработанных ДМСО неинфицированных (MOCK) или обработанных ДМСО инфицированных образцов в качестве калибратора в соответствующих экспериментах. Значения представляют собой кратную разницу для каждого состояния по сравнению с обработанными ДМСО неинфицированными или обработанными ДМСО инфицированными образцами. Планки погрешностей указывают ± стандартное отклонение индукции складки.

Для секвенирования различных сегментов вируса гриппа A резистентного к ASN2 вируса и рекомбинантных вирусов гриппа была проведена одностадийная ОТ-ПЦР с использованием одностадийной системы ОТ-ПЦР Superscript III с Platinum Taq High Fidelity (Invitrogen), согласно спецификации производителя.

Противовирусный биотест

Для проверки биологической активности цитокинов, высвобождаемых во время обработки инфицированных клеток ASN2, был проведен противовирусный биоанализ, как описано ранее, с некоторыми отличиями [45]. Клетки A549 помещали в 96-луночные планшеты с 50 мкл клеток (1 × 10 4 клеток / лунку) и инкубировали при 37 ° C, 5% CO 2 в течение 24 часов. Культуральную среду заменяли постинфекционной средой, содержащей соединение и 1 мкг / мл TPCK. После 2 часов инкубации их инфицировали rPR8 (MOI = 10) или WSN (MOI = 1), добавляя 10 мкл вирусного инокулята непосредственно в среду.Инфекцию вируса Сендай (SeV) использовали в качестве положительного контроля для индукции интерферона. Через 18 часов после инфицирования супернатанты собирали, и вирус, присутствующий в супернатанте, инактивировали УФ-излучением, помещая 96-луночный планшет в УФ-камеру, доставляющую 200 Дж / см 2 . Двукратные разведения инактивированных супернатантов добавляли к свежим клеткам VERO, предварительно засеянным в 96-луночные планшеты. После 24-часовой инкубации супернатанты клеток VERO аспирировали и клетки инфицировали 50 мкл NDV-GFP, разведенного в OptiMEM.(Концентрация используемого NDV-GFP была ранее определена для получения 90% экспрессии GFP через 24 часа). GFP визуализировали через 24 часа после заражения с помощью флуоресцентной микроскопии и количественно определяли с помощью планшет-ридера Beckman.

Процент ингибирования NDV-GFP, индуцированного супернатантами, рассчитывали по следующей формуле:% ингибитона = 100- (x / μ neg * 100), где x — исходный сигнал для каждой обработки, μ neg — средний сигнал для отрицательного контроля (MOCK: необработанные и инфицированные NDV-GFP клетки).

Глубокое секвенирование

Тотальную РНК выделяли из инфицированных клеток, обработанных ASN2 или ДМСО, как ранее описано в разделе «Выделение РНК». Обработку РНК и последующее секвенирование выполняли на установке секвенирования Mount Sinai с использованием анализатора генома Illumina (Illumina, Сан-Диего, Калифорния). Вкратце, мРНК выделяли с использованием шариков, покрытых олиго (dT), и затем фрагментировали с использованием набора Covaris RNA Shearing (Covaris, Woburn, Massachusetts). После осаждения РНК проводили синтез кДНК первой цепи с помощью обратной транскриптазы Superscript II (Invitrogen), случайных праймеров (Invitrogen) и ингибитора РНКазы (Invitrogen).Синтез второй цепи кДНК, репарацию концов, A-хвост и лигирование адаптера выполняли с использованием набора Illumina Sample Prep Kit (Illumina). Элюирование фрагментов кДНК и очистку геля проводили с использованием набора MinElute Gel Extraction Kit (Qiagen). Кусочек геля размером 200–300 п.н. вырезали перед выделением кДНК с помощью набора QIA Quick Gel Extraction Kit (Qiagen). ПЦР-амплификацию и очистку фрагментов проводили до секвенирования на платформе Illumina.

Последовательности

были сопоставлены с геномами как человека, так и вируса гриппа.Относительную численность нормализовали к значениям, полученным для мРНК GAPDH, и рассчитывали средние отношения между инфицированными клетками, обработанными ASN2 или DMSO. Отношения представляют собой кратную индукцию обработки ASN2 по сравнению с обработкой DMSO.

Вестерн-блот

Клетки дважды промывали холодным PBS и лизировали в 0,5% буфере для лизиса Nonidet P-40. Образцы обрабатывали на 4–20% готовых градиентных гелях (Bio-Rad, Hercules, CA) и переносили на поливинилиденфторидные (PVDF) мембраны (GE Healthcare, Бакингемшир, Великобритания).Белки GAPDH, PB1, NP, NS1, M1 и M2 были обнаружены с использованием кроличьих поликлональных антител против глицеральдегид-3-фосфатдегидрогеназы (GAPDH) (Sigma), кроличьих поликлональных антител против PB1 (полученных пептидной иммунизацией), моноклонального NS1 мыши. антитело (клон 1A7, Mount Sinai Hyridoma Facility), мышиное моноклональное антитело NP (клон 28D8, Mount Sinai Hyridoma Facility), мышиное моноклональное антитело M1 и M2 (клон E10, Mount Sinai Hyridoma Facility) и вторичные антитела, конъюгированные с пероксидазой хрена (GE Healthcare).

Эксперименты на животных
Заявление об этике.

Это исследование было проведено в строгом соответствии с рекомендациями Руководства по уходу и использованию лабораторных животных Национального института здоровья. Протокол был одобрен Комитетом по уходу и использованию животных школы медицины горы Синай (IACUC) (Animal Assurance No. A3111-01). В конце эксперимента мышей умерщвляли в соответствии с этими рекомендациями, и были приложены все усилия, чтобы свести к минимуму страдания.

Самок мышей BALB / c в возрасте от шести до восьми недель (Jackson Laboratory, Bar Harbor, ME) разделяли на группы по 9 мышей. Предварительная обработка проводилась путем введения одной дозы ASN2 (33,3 мг / кг), осельтамивира (0,5 мг / кг) или растворителя (33% ДМСО, 33% PBS и 33% Лабрафила (Gattefosse, Paramus, NJ)) внутрибрюшинно (IP). 8 часов и 1 час до заражения. Мышей анестезировали смесью кетамина и ксилазина IP и интраназально инфицировали вирусом гриппа A / WSN / 33 (5MLD 50 ).Обработка ASN2 (100 мг / кг / день), осельтамивиром (1,5 мг / кг / день) и соответствующими растворителями проводилась каждые 8 ​​часов в течение 8 дней. Вес тела и выживаемость контролировали ежедневно. Три мыши из каждой группы были умерщвлены на 3-й и 8-й дни после инфицирования, и титры вирусов в легких определялись с помощью анализа бляшек.

Микросомный анализ печени in vitro

Этот анализ был проведен Cyprotex. Объединенные микросомы печени мыши Balb / C (конечная концентрация белка 0,5 мг / мл), 0,1 М фосфатный буфер, pH 7.4 и ASN2 (конечная концентрация 3 мкМ в 0,25% ДМСО) предварительно инкубировали при 37 ° C перед добавлением НАДФН (конечная концентрация 1 мМ) для инициирования реакции. Контроли включали образцы, в которых отсутствовал НАДФН, и образцы, содержащие контрольные соединения, которые использовались в качестве внутренних стандартов. Образцы инкубировали в течение 0, 5, 15, 30 и 45 минут. Реакции останавливали добавлением 50 мкл метанола. Белок осаждали центрифугированием при 25000 об / мин в течение 20 минут при 4 ° C, и супернатанты анализировали с помощью ЖХ-МС / МС для обнаружения и количественного определения соединений в каждый момент времени.Внутренний клиренс и период полураспада рассчитывали из графика отношения площадей пиков (площадь пика ASN2 / площадь пика внутреннего стандарта) от времени.

Репортерные анализы IFNβ

Для анализов репортера IFNβ клетки A549 трансфицировали липофектамином LTX (Invitrogen). Трансфекцию проводили в 24-луночных планшетах при концентрации клеток 2 × 10 5 клеток / лунку для клеток A549 при соотношении липид-ДНК 2-1. 125 нг репортера IFNβ-LUC, 50 нг репортера pRL-TK и 325 нг пустого вектора pCAGGS или pCAGGS-NS1 трансфицировали в одну лунку с использованием 1 мкл реагента для трансфекции в 75 мл Opti-MEM.Инкубацию липидов и ДНК проводили при комнатной температуре в течение 30 минут перед добавлением комплекса трансфекции непосредственно к клеткам, содержащим обычную среду для роста. Через 24 часа после трансфекции клетки промывали и инфицировали вирусами гриппа (как указано) при MOI = 1 в течение 1 часа перед добавлением постинфекционной среды, содержащей DMSO или ASN2. Инфекции продолжались в течение 24 часов до анализа активности люциферазы с использованием набора для анализа люциферазы Dual-Glo (Promega) в соответствии со спецификациями производителя.

Анализ уменьшения образования зубного налета

Клетки высевали в 6-луночные планшеты до достижения 100% слияния. Указанные вирусы были разбавлены в 10 4 до 10 6 раз от их исходной концентрации. Каждое разведение использовали для заражения одного 6-луночного планшета с посевным материалом 200 мкл и инкубировали при комнатной температуре в течение 1 часа. Посевной материал вируса аспирировали и среду для покрытия бляшек, содержащую ДМСО или ASN2 (50 мкМ и 25 мкМ), добавляли к клеткам, которые инкубировали при 37 ° C, 5% CO 2 в течение 48-72 часов.Бляшки визуализировали путем иммуноокрашивания антителом к ​​NP и вторичным антителом, конъюгированным с пероксидазой хрена.

Анализы минигенома вируса гриппа

Для репортерных анализов минигенома вируса гриппа A клетки A549 трансфицировали липофектамином LTX (Invitrogen). Трансфекцию проводили в 24-луночных планшетах при концентрации клеток 2 × 10 5 клеток / лунку для клеток A549 при соотношении липид-ДНК 2-1. 75 нг репортера WSN NP_LUC, 50 нг репортера pRL-TK, 50 нг плазмид экспрессии WSN PB1, WSN PB2 и WSN PA и 100 нг плазмиды экспрессии WSN NP (или пустой вектор для отрицательного контроля) котрансфицировали 0 .75 мкл реагента для трансфекции в 0,75 мл Opti-MEM. Инкубацию липидов и ДНК проводили при комнатной температуре в течение 30 минут перед добавлением комплекса трансфекции непосредственно к клеткам, содержащим среду после инфицирования (без TPCK) с добавлением ASN2 или DMSO. Через 24 часа после трансфекции клетки лизировали и измеряли продукцию люциферазы с помощью набора для анализа люциферазы Dual-Glo (Promega) в соответствии со спецификациями производителя. Для анализа минигенома вируса гриппа B использовали плазмиду, кодирующую ген хлорамфениколацетилтрансферазы (CAT), фланкированный некодирующими областями из NS-сегмента вируса гриппа B / Lee / 40 (pPOLI-B / Lee / 40 NS-CAT). использовали [46].Конструкции экспрессии PB1, PB2, PA и NP были получены из вируса гриппа B / Yamagata / 88. Экспрессию CAT оценивали с помощью ELISA (Roche).

Анализ удлинения праймера

клеток A549 высевали в чашки диаметром 10 см (Corning) при 2,5 × 10 6 клеток / чашку в обычной питательной среде и инкубировали при 37 ° C, 5% CO 2 в течение 24 часов. Затем среду для культивирования клеток заменяли постинфекционной средой (с 1 мкг / мл TPCK), содержащей ДМСО, ASN2 (50 мкМ, 25 мкМ и 12,5 мкМ) или рибавирин (100 мкМ), за 4 часа до инфицирования.Затем клетки промывали PBS и инфицировали WSN в среде для инфицирования PBS / 0,5% BSA (MOI = 5) в посевном материале объемом 1 мл. После 1 часа инкубации при комнатной температуре инокулят вируса аспирировали, клетки промывали PBS и среду после инфицирования (с 1 мкг / мл TPCK), содержащую соответствующие соединения, добавляли к клеткам и инкубировали в течение 6 часов. РНК экстрагировали с помощью набора RNeasy Mini Kit (Qiagen). Мечение праймеров, реакцию удлинения праймеров и гель-анализ продуктов проводили с использованием набора Primer Extension System — AMV Reverse Transcriptase (Promega) в соответствии со спецификациями производителя.Праймеры, используемые для удлинения праймеров, можно найти в [34]. Полученные блоты визуализировали с помощью фосфорного сканера Typhoon Variable Mode Imager (GE Heathcare, Piscataway, NJ) и количественно оценивали с помощью программного обеспечения ImageJ.

Дополнительная информация

Рисунок S1.

Схема грохота высокопроизводительного компаунда. В ходе первичного скрининга (1) клетки MDCK IFNβ-люциферазы высевали в 384-луночные планшеты и инкубировали в течение 20 часов перед переносом соединений штырями. Два часа спустя лунки инфицировали вирусом гриппа A / PR / 8/34 (MOI = 10) в течение 18 часов перед измерением активности люциферазы.Две колонки в каждой чашке были зарезервированы для контролей и не содержали соединений. Предпоследняя колонка была инфицирована только вирусом PR8 дикого типа (отрицательный контроль), а последняя колонка была инфицирована только вирусом PR8 NS1-113 (положительный контроль). Первичные совпадения были идентифицированы после расчета Z-показателя для каждого соединения и применения критериев попадания, как указано. Вторичный скрининг (2) был проведен с 250 соединениями из 264 идентифицированных совпадений. Этот скрининг был выполнен в 96-луночном формате и включал показанные вторичные анализы.Подтвержденные совпадения (27) были отобраны на основе указанных критериев подтверждения. Эти совпадения были разделены на две группы: соединения, которые индуцируют IFNβ независимо от вирусной инфекции, и соединения, которым требуется вирусная инфекция для индукции IFNβ. ASN2 был выбран в качестве ведущего соединения (3) для дальнейшей оценки.

doi: 10.1371 / journal.ppat.1002668.s001

(TIF)

Рисунок S2.

Репликация вируса гриппа A необходима для индукции интерферона после лечения ASN2.(A) Анализ qRT-PCR мРНК IFNβ и ISG56 в клетках A549, инфицированных A / WSN / 33 (MOI = 1) и обработанных снижающимися концентрациями ASN2 (50-12,5 мкМ) в течение 24 часов. (B) qRT-PCR анализ мРНК IFNβ и ISG56 в клетках A549, инфицированных УФ-инактивированным A / WSN / 33 (MOI = 1) и обработанных снижающимися концентрациями ASN2 (50-12,5 мкМ) в течение 24 часов. Обработку IFNβ (50 МЕ / мл) использовали в качестве положительного контроля. Значения были нормализованы к α-тубулину для каждого образца и представлены как кратная индукция по сравнению с неинфицированным образцом, обработанным ДМСО.Планки погрешностей отражают стандартное отклонение кратного изменения.

doi: 10.1371 / journal.ppat.1002668.s002

(TIF)

Рисунок S3.

ASN2 предпочтительно ингибирует продукцию вирусной мРНК из меньших сегментов генома вируса гриппа. (A) Анализ глубокого секвенирования мРНК вируса гриппа в клетках A549, инфицированных A / WSN / 33 (MOI = 1) и обработанных DMSO или ASN2 (50 мкМ) в течение 24 часов. Ось Y представляет собой общее количество считываний для каждой конкретной последовательности (длиной 50 нт), а ось X представляет положение каждого считывания в вирусном геноме.(B) Анализ считываний последовательностей из части A. Значения были нормализованы к общему количеству считываний для каждого образца и представлены как соотношение ASN2 / DMSO.

doi: 10.1371 / journal.ppat.1002668.s003

(TIF)

Рисунок S4.

ASN2 — уникальное противовирусное соединение, индуцирующее интерферон. qRT-PCR анализ мРНК IFNβ в клетках A549, инфицированных вирусом гриппа A / WSN / 33 (MOI = 1) и обработанных ASN2 (50 мкМ) или A3 (10 мкМ) в течение 24 часов. Значения были нормализованы к α-тубулину для каждого образца и представлены как кратная индукция по сравнению с неинфицированным образцом, обработанным ДМСО.Планки погрешностей отражают стандартное отклонение кратного изменения.

doi: 10.1371 / journal.ppat.1002668.s004

(TIF)

Таблица S1.

Транскрипционный профиль генов, индуцированных ASN2 в инфицированных вирусом гриппа клетках.

doi: 10.1371 / journal.ppat.1002668.s005

(TIF)

Таблица S2.

Консервация аминокислот в положении 499 белка PB1 вируса гриппа А.

DOI: 10.1371 / journal.ppat.1002668.s006

(TIF)

Благодарности

Мы благодарим Су Чанга и Дэвида Вробеля из Национальной лаборатории скрининга региональных центров передового опыта в области биозащиты и новых инфекционных заболеваний (NSRB) (Гарвардская медицинская школа, Бостон, Массачусетс) за их помощь в проведении высокопроизводительного скрининга. Мы также благодарим Рави Сачиданандама и Хардика Шаха из центра секвенирования Mount Sinai за обработку образцов глубокого секвенирования. Также мы хотели бы поблагодарить Луиса Мартинеса-Собридо, Циншана Гао, Ронг Хай, Марка Йондола, Алину Петерсон, Мэтью Эванса, Ану Фернандес-Сесма, Адольфо Гарсиа-Састре, Бенджамина теновер, Жужанну Варгу, Джениш Пател и Генрих Хоффманн. предложения, реагенты и полезные обсуждения.

Вклад авторов

Задумал и спроектировал эксперименты: MBO PP MLS. Проведены эксперименты: MBO OD JM LMG VHLG PA JA. Проанализированы данные: МБО ПП МЛС. Предоставленные реагенты / материалы / инструменты для анализа: MBO OD JM LMG VHLG JA PP MLS. Написал статью: MBO MLS.

Ссылки

  1. 1. Палезе П., Шоу М.Л. (2007) Orthomyxoviridae: вирусы и их репликация. В: Книп Д.М., Хоули П.М., редакторы. Области вирусологии. 5-е изд. Филадельфия: Липпинкотт Уильямс и Уилкинс.С. 1647–1690.
  2. 2. CDC (2011) Грипп: болезнь. Центры профилактики заболеваний. Доступно: http://www.cdc.gov/flu/about/disease/index.htm.
  3. 3. Баутиста Э., Чотпитаясунондх Т., Гао З., Харпер С.А., Шоу М. и др. (2010) Клинические аспекты инфекции, вызванной пандемическим вирусом гриппа A (h2N1) 2009 г. N Engl J Med 362: 1708–1719.
  4. 4. Эрнандес Дж. Э., Адига Р., Армстронг Р., Базан Дж., Бонилла Н. и др. (2011) Клинический опыт у взрослых и детей, получавших перамивир внутривенно от гриппа A (h2N1) 2009 г. в рамках программы Emergency IND в США.Clin Infect Dis 52: 695–706.
  5. 5. Джексон Р.Дж., Купер К.Л., Таппенден П., Рис А., Симпсон Е.Л. и др. (2011) Осельтамивир, занамивир и амантадин в профилактике гриппа: систематический обзор. J Заражение 62: 14–25.
  6. 6. Pinto LH, Lamb RA (2007) Контроль репликации вируса гриппа путем ингибирования его протонного канала. Мол Биосист 3: 18–23.
  7. 7. Сираиси К., Митамура К., Сакаи-Тагава Ю., Гото Х., Сугая Н. и др. (2003) Высокая частота устойчивых вирусов, несущих различные мутации, у детей с гриппом, получавших амантадин.J Infect Dis 188: 57–61.
  8. 8. Гартен Р.Дж., Дэвис С.Т., Рассел К.А., Шу Б., Линдстрем С. и др. (2009) Антигенные и генетические характеристики вирусов гриппа 2009 A (h2N1) свиного происхождения, циркулирующих среди людей. Science 325: 197–201.
  9. 9. Брайт Р.А., Шей Д.К., Шу Б., Кокс Н.Дж., Климов А.И. (2006) Устойчивость к адамантану среди вирусов гриппа А, выделенных в начале сезона гриппа 2005–2006 гг. В Соединенных Штатах. JAMA 295: 891–894.
  10. 10. Renaud C, Kuypers J, Englund JA (2011) Возникающая устойчивость к осельтамивиру при сезонном и пандемическом гриппе A / h2N1.J Clin Virol 52: 70–78.
  11. 11. Фурута Ю., Такахаши К., Шираки К., Сакамото К., Сми Д.Ф. и др. (2009) T-705 (фавипиравир) и родственные соединения: новые ингибиторы широкого спектра действия вирусных инфекций, вызываемых РНК. Противовирусный Res 82: 95–102.
  12. 12. Кисо М., Такахаши К., Сакаи-Тагава Ю., Шинья К., Сакабе С. и др. (2010) Активность Т-705 (фавипиравира) против летальных вирусов гриппа A H5N1. Proc Natl Acad Sci U S A 107: 882–887.
  13. 13. Фурута Ю., Такахаши К., Куно-Маекава М., Сангава Х., Уехара С. и др.(2005) Механизм действия Т-705 против вируса гриппа. Антимикробные агенты Chemother 49: 981–986.
  14. 14. Гарсия-Састре А., Бирон CA (2006) Интерфероны типа 1 и отношения вирус-хозяин: урок разрядки. Наука 312: 879–882.
  15. 15. Гарсия-Састре А., Егоров А., Матасов Д., Брандт С., Леви Д. Е. и др. (1998) Вирус гриппа A, лишенный гена NS1, реплицируется в интерферон-дефицитных системах. Вирусология 252: 324–330.
  16. 16. Hale BG, Randall RE, Ortin J, Jackson D (2008) Многофункциональный белок NS1 вирусов гриппа А.J Gen Virol 89: 2359–2376.
  17. 17. Куинливан М., Замарин Д., Гарсия-Састре А., Куллинан А., Чемберс Т. и др. (2005) Ослабление вирусов гриппа лошадей за счет усечения белка NS1. J Virol 79: 8431–8439.
  18. 18. Солорзано А., Уэбби Р. Дж., Лагер К. М., Янке Б. Х., Гарсия-Састре А. и др. (2005) Мутации в белке NS1 вируса гриппа свиней ухудшают антиинтерфероновую активность и вызывают ослабление у свиней. J Virol 79: 7535–7543.
  19. 19.Steel J, Lowen AC, Pena L, Angel M, Solorzano A и др. (2009) Живые аттенуированные вирусы гриппа, содержащие укороченные NS1, в качестве кандидатов в вакцины против высокопатогенного птичьего гриппа H5N1. J Virol 83: 1742–1753.
  20. 20. Фалькон А.М., Фернандес-Сесма А., Накая Ю., Моран Т.М., Ортин Дж. И др. (2005) Ослабление и иммуногенность у мышей чувствительных к температуре вирусов гриппа, экспрессирующих усеченные белки NS1. J Gen Virol 86: 2817–2821.
  21. 21. Мюллер С.Н., Лэнгли В.А., Карнеро Э., Гарсия-Састре А., Ахмед Р. (2010) Иммунизация живыми ослабленными вирусами гриппа, которые экспрессируют измененные белки NS1, приводит к мощным и защитным ответам CD8 + Т-клеток памяти.J Virol 84: 1847–1855.
  22. 22. Basu D, Walkiewicz MP, Frieman M, Baric RS, Auble DT, et al. (2009) Новые антагонисты NS1 вируса гриппа блокируют репликацию и восстанавливают врожденную иммунную функцию. J Virol 83: 1881–1891.
  23. 23. Хай Р., Мартинес-Собридо Л., Фрейзер К. А., Эйллон Дж., Гарсия-Састре А. и др. (2008) Усеченные по NS1 мутанты вируса гриппа B: подход с использованием живой аттенуированной вакцины. J Virol 82: 10580–10590.
  24. 24. Чжан Дж. Х., Чунг Т. Д., Ольденбург К. Р. (1999) Простой статистический параметр для использования при оценке и валидации высокопроизводительных скрининговых анализов.J Biomol Screen 4: 67–73.
  25. 25. Lopez CB, Yount JS, Hermesh T, Moran TM (2006) Сендайская вирусная инфекция индуцирует эффективный адаптивный иммунитет независимо от интерферонов типа I. J Virol 80: 4538–4545.
  26. 26. Desmyter J, Melnick JL, Rawls WE (1968) Дефектность производства интерферона и вмешательство вируса краснухи в линию клеток почек африканской зеленой мартышки (Vero). J Virol 2: 955–961.
  27. 27. Mosca JD, Pitha PM (1986) Транскрипционная и посттранскрипционная регуляция экзогенного гена бета-интерферона человека в обезьяньих клетках, дефектных по синтезу интерферона.Mol Cell Biol 6: 2279–2283.
  28. 28. Emeny JM, Morgan MJ (1979) Регулирование системы интерферона: доказательства того, что клетки Vero имеют генетический дефект в производстве интерферона. J Gen Virol 43: 247–252.
  29. 29. Hoffmann HH, Palese P, Shaw ML (2008) Модуляция репликации вируса гриппа путем изменения транспорта ионов натрия и активности протеинкиназы C. Противовирусный Res 80: 124–134.
  30. 30. Фодор Э., Девениш Л., Энгельгардт О.Г., Палезе П., Браунли Г.Г. и др.(1999) Спасение вируса гриппа А от рекомбинантной ДНК. J Virol 73: 9679–9682.
  31. 31. Сквайрс Б., Маккен С., Гарсия-Састре А., Годбол С., Норонья Дж. И др. (2008) BioHealthBase: информационная поддержка в выяснении взаимодействий и вирулентности патогенов вируса гриппа-хозяина. Nucleic Acids Res 36: D497-503.
  32. 32. Muller R, Poch O, Delarue M, Bishop DH, Bouloy M (1994) L-сегмент вируса лихорадки Рифт-Валли: коррекция последовательности и возможная функциональная роль вновь идентифицированных областей, консервативных в РНК-зависимых полимеразах.J Gen Virol 75 (Pt 6): 1345–1352.
  33. 33. Mahmoudian S, Auerochs S, Grone M, Marschall M (2009) Белки PB1 и NS1 вируса гриппа A подвергаются функционально важному фосфорилированию протеинкиназой C. J Gen Virol 90: 1392–1397.
  34. 34. Robb NC, Smith M, Vreede FT, Fodor E (2009) Белок NS2 / NEP регулирует транскрипцию и репликацию генома РНК вируса гриппа. J Gen Virol 90: 1398–1407.
  35. 35. Перес Дж. Т., Варбл А., Сачиданандам Р., Златев И., Манохаран М. и др.(2010) Генерируемые вирусом гриппа А малые РНК регулируют переключение от транскрипции к репликации. Proc Natl Acad Sci U S A 107: 11525–11530.
  36. 36. Hatada E, Hasegawa M, Mukaigawa J, Shimizu K, Fukuda R (1989) Контроль экспрессии гена вируса гриппа: количественный анализ каждого вида вирусной РНК в инфицированных клетках. J Biochem 105: 537–546.
  37. 37. Shapiro GI, Gurney T Jr, Krug RM (1987) Экспрессия гена вируса гриппа: механизмы контроля на ранних и поздних этапах инфекции и ядерно-цитоплазматический транспорт вирус-специфичных РНК.Дж. Вирол 61: 764–773.
  38. 38. Varghese JN, Smith PW, Sollis SL, Blick TJ, Sahasrabudhe A, et al. (1998) Разработка лекарств против меняющейся цели: структурная основа устойчивости к ингибиторам в варианте нейраминидазы вируса гриппа. Структура 6: 735–746.
  39. 39. Зайберт К.В., Камински М., Филипп Дж., Руббенстрот Д., Альбрехт Р.А. и др. (2010) Устойчивые к озельтамивиру варианты пандемического вируса гриппа h2N1 2009 г. не ослаблены в моделях передачи от морских свинок и хорьков.J Virol 84: 11219–11226.
  40. 40. Су CY, Cheng TJ, Lin MI, Wang SY, Huang WI и др. (2010) Высокопроизводительная идентификация соединений, нацеленных на РНК-зависимую РНК-полимеразную активность гриппа. Proc Natl Acad Sci U S A 107: 19151–19156.
  41. 41. Hoffmann HH, Kunz A, Simon VA, Palese P, Shaw ML (2011) Противовирусное средство широкого спектра действия, которое препятствует биосинтезу пиримидина de novo. Proc Natl Acad Sci U S A 108: 5777–5782.
  42. 42. Нива Х., Ямамура К., Миядзаки Дж. (1991) Эффективный отбор трансфектантов с высокой экспрессией с новым эукариотическим вектором.Gene 108: 193–199.
  43. 43. Парк М.С., Шоу М.Л., Муньос-Джордан Дж., Крос Дж. Ф., Накая Т. и др. (2003) Анализ на основе вируса болезни Ньюкасла (NDV) демонстрирует антагонистическую активность интерферона в отношении белка V NDV и белков V, W и C вируса Нипах. J Virol 77: 1501–1511.
  44. 44. Ливак К.Дж., Шмитген Т.Д. (2001) Анализ данных относительной экспрессии генов с использованием количественной ПЦР в реальном времени и метода 2 (-Delta Delta C (T)). Методы 25: 402–408.
  45. 45.Konig R, Stertz S, Zhou Y, Inoue A, Hoffmann HH и др. (2010) Человеческие факторы хозяина, необходимые для репликации вируса гриппа. Природа 463: 813–817.
  46. 46. Парагас Дж., Талон Дж., О’Нил Р. Э., Андерсон Д. К., Гарсия-Састре А. и др. (2001) Белки NEP (NS2) вирусов гриппа B и C обладают ядерной экспортной активностью. J Virol 75: 7375–7383.

В Санкт-Петербурге прошла выездная медиа-конференция «Архитектура здоровья. Роль СМИ »

6–7 июня г.В Петербурге прошла выездная медиа-конференция «Архитектура здоровья. Роль СМИ», спонсорами которой выступили «Петровакс Фарм» и Группа «Интеррос». Мероприятие, посвященное поддержанию иммунитета и иммунизации, совпало с 16 -м Всероссийским. научный форум «Дни иммунологии в Санкт-Петербурге». Более 70 ведущих специалистов по вакцинации, иммунологов и педиатров, а также представители специализированных, деловых и общественно-политических СМИ Москвы и Санкт-Петербурга.Петербург принял участие в научно-практической конференции и круглом столе.

6 июня на симпозиуме «Сдерживание инфекций» медицинские эксперты отметили несколько критических периодов в развитии иммунной системы: первые 6 месяцев жизни, 1–3 года и половое созревание. Таким образом, по мнению Андрея Шульженко , заведующего отделом аллергологии и иммунологии ФГБУ Государственный научный центр «Институт иммунологии» ФМБА России, не вакцинировать и не вакцинировать своего ребенка — устаревший и опасный подход.

На этом же симпозиуме Костинов Михаил , заведующий лабораторией иммунизации и иммунотерапии И. И. Мечников Научно-исследовательский институт вакцин и сывороток отметил, что из-за массовой вакцинации заболеваемость гриппом и ОРВИ в России снизилась почти в десять раз за последние 20 лет. В эпидемическом сезоне 2015–2016 гг. Было зарегистрировано 60,5 случая гриппа и ОРВИ на 100 000 населения. Заболеваемость гриппом среди детей грудного и раннего возраста была в 6 раз выше, чем среди взрослых.Зафиксировано 623 смертельных случая гриппа, из них 30 — у детей до 17 лет.

В свете вышеизложенного специалисты рекомендуют родителям повышать свой образовательный и образовательный уровень. В настоящее время медики используют термин «болезненные» дети. Кто такие «хилые»? Например, дети в возрасте от 1 до 3 лет с 6+ эпизодами ОРВИ в год или дети более старшего возраста с 5+ эпизодами ОРВИ в год. «Родителям стоит отвести ребенка к иммунологу только тогда, когда становится очевидным, что болезнь постепенно прогрессирует, когда появляются множественные поражения различных органов и продолжительные продолжительные рецидивы болезни», — сказала Сюзанна Харит , Главный независимый Эксперт по детской иммунизации Санкт-Петербурга.Комитет здравоохранения Санкт-Петербурга, заведующий отделом иммунизации НИИ детских инфекций ФМБА России. По словам г-жи Харит, за последние 40 лет нерациональный Схема использования антибиотиков кардинально не изменилась. Иммунологи не устают повторять, что случайное использование «самописанный» антибиотики вызывают микробную лекарственную устойчивость. Поэтому лечить ребенка антибиотиками 4–6 раз в год, даже если они назначены врачом, является преступлением.

7 июня во время круглого стола «Архитектура здоровья.Роль средств массовой информации »в Центре архитектуры, эксперты продолжили говорить о роли иммунизации, поддержании иммунитета и важности средств массовой информации в донесении до пациентов достоверной информации.

«Человечество знает многих выдающихся архитекторов, овладевших принципами проектирования и гармоничного расположения зданий в пространстве. Их мудрость применима и к архитектуре здоровья. Так же, как невозможно построить здание без прочного фундамента, и пойти в медицину, не зная латыни, поэтому хорошее здоровье не обходится без сильного иммунитета », — сказал во вступительной речи Максим Овчаренко , генеральный директор компании« Новая высота »Consulting.

«В наши дни очень сложно поддерживать стойкий иммунитет, так как неблагоприятные факторы существенно влияют на иммунную систему человека», — сказала Людмила Лусс , заведующая научно-консультационным отделом ФГБУ Государственный научный центр «Институт иммунологии». ФМБА России. «Плохое экологическое состояние, стрессы, перенапряжение, неправильное питание, вредные привычки, малоподвижный образ жизни и бесконтрольный прием лекарств вызывают иммунную дисфункцию, которая проявляется в частых обострениях хронических воспалительных заболеваний, в том числе ОРВИ и других инфекций.Для поддержания иммунитета важно укреплять здоровье, в том числе за счет правильного питания, физических упражнений и кондиционирования. При иммунных нарушениях могут быть показаны иммуномодуляторы ».

«Люди на 90% состоят из микробов», — отметила Екатерина Кажарская , медицинский консультант компании «Петровакс Фарм». «По данным Национального института здоровья США, только 10% клеток, составляющих человеческое тело, являются человеческими. Остальные 90% клеток принадлежат человеческим бактериям.Антибиотики не всегда эффективны при лечении инфекционных заболеваний. Вдобавок к этому они имеют множество побочных эффектов, и их необходимо отменить или заменить. Вакцинация и иммунотропная терапия обеспечивают профилактику заболеваний или снижение их тяжести и осложнений ».

Директор по коммуникациям группы «Интеррос» Антон Муравьев и генеральный директор ByconGroup Игорь Райхман остановились на освещении в СМИ заболеваемости гриппом, а также на опросе общественного мнения относительно отношения к иммунизации.«Мы зафиксировали следующую специфику: средства массовой информации все больше сосредотачиваются на гриппе как на федеральном, так и на региональном уровне. Но это сезонный фокус. Когда начинается кампания вакцинации, средства массовой информации переходят к этой проблеме. Эпидемия заканчивается, все забывают о гриппе, ОРВИ, о необходимости поддерживать свое здоровье круглый год, чтобы быть готовым к сезону эпидемии, среди прочего. Среди опрошенных наблюдается дисбаланс в отношении используемых источников информации.Таким образом, специализированным источникам доверяют наравне с Интернетом и друзьями, но наименьший процент респондентов читает специализированные СМИ. Также наблюдается дисбаланс в отношении к вакцинации в столице и регионах России из-за отсутствия единой информационной политики », — отметили эксперты. Они пришли к выводу, что целью фармкомпаний, государства, СМИ и гражданского общества было объединение. их усилия покончить с неосведомленностью населения о вакцинации и иммунизации на по всей стране шкала.

«К сожалению, в этой стране люди, далекие от медицины, любят комментировать вопросы иммунизации», — отметил Даниил Ткачев , РИА AMI COO. В своем выступлении г-н Ткачев раскрыл интересные факты обо всех, кто выступал против вакцинации. Но, продолжил он, проблема заключалась в том, что уровень доверия населения к негативной информации был выше, чем к объективной информации от компетентных экспертов.

«Средства массовой информации часто хватаются за сенсацию и распространяют непроверенную информацию.В то же время они гораздо менее охотно публиковать положительные результаты исследований иммунизации », — продолжила Людмила Лусс .

«Мы надеемся, что благодаря таким сессиям взаимодействие отраслевого эксперта со СМИ станет более тесным. Предоставление объективной информации — наша общая ответственность на благо здоровья пациентов», — резюмировала Ольга Маценко , директор компании «Петровакс Фарм» Корпоративные коммуникации и GR.

Антибиотики: знайте, когда они вам нужны

Антибиотики: знайте, когда они вам нужны | Атриум Здоровье × Обновление ограничений для посетителей: Из-за COVID-19 ограничения для посетителей действуют.Узнать больше.

У каждого человека в организме есть микробы, называемые бактериями и вирусами.Есть «хорошие бактерии», которые помогают нам оставаться здоровыми, но вирусы обычно вызывают болезни.

Антибиотики — это мощные лекарства, которые могут бороться с инфекциями и спасать жизни, убивая бактерии в вашем теле. Хотя антибиотики могут помочь вылечить бактериальные инфекции, они не помогут бороться с такими вирусами, как простуда или грипп. а прием антибиотика, когда он вам не нужен, может иметь серьезные последствия.

Хорошие новости? Если вы знаете разницу между бактериями и вирусами и когда уместно принимать антибиотики, вы можете бороться с инфекциями должным образом и чувствовать себя лучше.

Как работают антибиотики — и почему они не действуют

  • Антибиотики — это лекарства, которые убивают микробы бактерий и могут лечить только болезнь, вызванную бактериями, также известную как бактериальная инфекция. Это включает стрептококковое горло, инфекции мочевыводящих путей (ИМП) и многие кожные инфекции.
  • Антибиотики не действуют при болезнях, вызванных вирусными микробами, также известными как вирусная инфекция. Это включает большинство симптомов гриппа и простуды, таких как ангина, инфекции носовых пазух, простуда грудной клетки и бронхит.
  • Если вы принимаете антибиотик, когда он вам не нужен, например, при простуде или гриппе, это может ухудшить ваше самочувствие и продлить болезнь. На самом деле, при неправильном применении антибиотики могут вызвать больше тяжелые заболевания, такие как диарея, тошнота и сыпь.
  • Прием антибиотика, когда он вам не нужен, также может сделать ваше тело устойчивым к антибиотикам — это означает, что в следующий раз, когда вам действительно понадобятся антибиотики для борьбы с бактериальной инфекцией, они могут не сработать, чтобы вылечить вас.

Узнать больше